Description :
From Genome Similarity Track
Location :
Scaffold_761:18066- 19735
Transcript NameFunction/comments
Phyta_totarag10582hypothetical protein

Sequence
1669 bases(100 bases per row)
ACAAGGAGCAAGTGGTATCCGATATCCCTGCCTTCCGTCGTTAATTGCCTCAGTATGTTGTTTGTTCTCTGCAGGGAATCCGTCTATCCTCGAGTTGAAT
ATCTTACTCTTGCTgccaatacatgtagcccCGCTGTTTCTGCAGTACGACATCCAGGAGGCGACTTTCAGAGTGCGCTACAACGTTGCGCGTGGGCTGC
CCCAGCGGATGGCCGGGGATCGCATGGAGTGTGGGTACGTGAGAACTACGCTGACGATCTTGCCGATGAAAACTTACAAATGCTCTTGTGTGTTTATCCA
CAGAGTTTGCTGGATGGATTTCACGCCACTCCGGGTCATGCTCCTCAAGTGTGAGCACTACATCTGCGCCCCATGCCTCCGCTTGCTACCACGCAAAGAG
TGTCCGTATTGCCGGTAAGTCGTGCAACCAACGACAATTGAGTAGCAACGAGTTCTCATGGTGTCTATGCGTCTCAATATGTTTTGACCGACCGACCAGT
GGGCCAATTCGATTCGCGCAACCTGTGAGTGAGATTGTGAAGCGAGAGGCGCTTCGGCTCTTGATAGAGTCGGTGGAACTCAAAGACCAACCTGCAACCC
CCAATTCCGAAGCAGACCAACCAGTGGTACCAACCAACGTGAGGGACAACAACCCAAAAGGCCAAAAACCACCAAACCACGATGGCGAACCTGAAAAATG
GCAACTGACAACCGATTTCTCGCAAAATCAAGAACCCGACGACAAACACGAAGGTACCAGCTAAACCGATCCTCTACAAGATCCTTCATGCCAAGAATCA
CCGATAACATCCGATGAAGGCAACATAAGATCAGTCTCAGTAATACTTTCCCAAAATTTGGGCTAATCAACATGCATTAAACTGGTCTTTTACATTCTCC
ATTGATTTTTTTGCCAAAAAATTGTTGGGGAAAGGTATGGAGCAGATCCAAGAGCTCCCGAACGGCAAATGCATCCGCAAGTACTCGCCCGATCACGCGC
TGTTCGATGCCGGCACGCGTCTGTGGGCGACTAAGTATTACCAAGAGCCAGAGTGCGTTAACAGTGCTGTAATATGTGCAGTAAAAAGTTTGCAGTAGTA
GAAGTAAAATTTATATTGATGAAATTCGTGAATTGGTGACGCAGATCTATGGTGCAGCCGGGAGAAGCCGTgggtgaagctgctcaagcgccCCCTATCA
CGTGTCACCTGGCAAAATGCAACGTGAGTTTCCAGTCCGTTGCGGCGTACGAGGAGCACTACGACATGTACGTGTAGGCAGCACGCAGCAAAGGAGACTG
AGGACTAAGCAAAAACCTTTATGCtgttattgttgttgtgaaTACCGTAGGGTGCACCGCAATATTTGTCGCGAGTGCTCAAGGTCGTTCCTGAGTTTAC
GCCTGCTGGATATTCACATCAGGTGAGGAGGTGTAGGAGTTTTTCAGCTTTGGAGATTTTGAATGAACTGAAGGTGTTGGGGTTGTGCACTTTGGTAGTG
AGACCCACGACGCTTTCTTCAAGATTCTGtccaagaagcagccgaTGTATATTTGCTTGGTGGACGGCTGTCCGGAGACTTTCCTGCACGATGACAAGCG
AACCAGACATTTGATCCAAGTGCACCAGTATCCAGAGTCATTCTCGTTCCAACAGCGGCGTAAGCAGAA