Description :
From Genome Similarity Track
Location :
Scaffold_19:180650- 183923
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007672Similar to pepA: Probable cytosol aminopeptidase (Protochlamydia amoebophila (strain UWE25))
Pytul_DAOMBR144PYU1_G007671Protein of unknown function
Pytul_DAOMBR144PYU1_G007670Similar to snt-1: Synaptotagmin-1 (Caenorhabditis elegans)

Sequence
3273 bases(100 bases per row)
TGCCGAGGTTGCGCGCAAAGATGGTCTCTTCTCCAAGCGTGATCTGCTCCGTCACATTCTGCGCTCGTGAAAACAAAAACAAAGACGTGAGTGAGAACAA
ATGCCTCGTGCGATCTGGACTGAGGAAAAGCAAAGTTGCCTGCCTACCTTTTGGAATTCCTCGCTCGCGGCCAAGAAGATCTTCTCCAATGGCAGCTTCA
GTTTGTCCTCGCCATTCTCGTCCTTTTCAGCGCTCAGATACTTGTCAAACTGGTAGTTGGACAGAATCGACGCCTACACGCAATCCAAAGAAGAACGCCA
CGTCAATGGTGATGATATCCTTTCAAGCTCTTCTACCTGGGAGTACCACCTACCTGCGAGATGAGTTCGACGACGCGCTCTTGCTTCAGCGTCGAATCCT
TGAGCTCTGGGAGCTGCAGCACCACGTCCTTTGCGCGCTTGGCCTTCAGCACACTCAACGCACCGTGCGTGGCGTTGCGCAGCAGTTCGTCGTTCACCTT
GTCGGCCGCACCGAGACCGACCAGCAGCACACGTTCATTCTCATACTTTGCGTCGTCGCCGCTTGGGTACAGGTACAATTTCTCCTGCGGTTTGGCGTGG
AAGTCCTTGAGCGCGTGCGTGGACACTGGGAACGGCAGCGCAGCCTGGAGCGCTGCCGTCGCGTCACTCTCGGCCTTGGTCACAAACAGCACGCGCGTCT
TGGACGGCAGCTGCTCGGCGTTCGGCGCCACGAGCGCGATTTCGCCCTGCACGCGCTGCTGCACGAGCCGATGCGCTGCGTCTGCGCTCAAGAAGCGCGC
GTTGCGGACCGCCGTGCGCGCGCGCAGCAGCGGCGCCATCGTCATTGTCATCACTCGCACCATCTCGTCCCAATTGCAAAAATGTGCGGTGAATCGGACA
CAATGCAGCAATGCAACGCAATGCAATGTATAATTTCGACCAATGCAATATATGGTACTGGTTTGCTTAACGATAAATGAACAATAAATGATTGGCTGAA
ATTGTCATGCTGGTTTTATATAGAAAGTTTGGCTTGGCTCGGCTTGAAAGCTTTTTTTGGCGCCAACACAAATAAATTACGAGAATATATTGGTCCCATA
ACCAGACCATCACAATGGTATCAAGCTAAAACAAAGTTTTTGCTGGAGAAGGAAGGCGGTGTGAAGATGGCGGTAGCAGCGCCGCCGCTGCTGTTCTCCA
TGCAGTTCTATCTCAACGACCTCAGCCTGTTTCTTACACCTACGCATTCCAGCGCCGCGCAGAGTGCAGACGCGTCCGCAGGCTACGACGCCAAGTTCCT
CGTCGGCTTCCAATTGCTCCAGTACGAAATCGTGCTCTTTGATCCCGTCGACGCCCTGAGCATTGCCCAAGCAGCTGCAGATAACGAACAAGAGCTATCA
AGTAGTAATGACGGTGACGTTGTCGCCATGAAGCTTCAGCACGGCAAGTCGTGTCTCTTTGAAGCCAATGCGGACCACTTGGCGATGGATCTGCAGCGAG
AATGTGAGGCGCCGCTGACGCTGCTGGTCATGCAGCAGGACCACGGGAAAGCGCGTCTCGTGGCATTTGCGAGCATCCCCATTGAACTCCATGTGGGGCT
GTTCCGTAAAGCGACTGAAGGCGAAAATGGCCACGAGACAGTGTCGATGCAGACTGAGATGCGATTCCGGGTGTGTGAATGGGCGAGCAGCAGCGGCACG
TGGGAGCTCAAAGATCACGCAAATCAAGTCGTTGGAAGCGCAACGGGCGCCGTGACGCTCTCTTGTCTGGGCCAAGCGCTTACGCCACATCTCGTGCATG
CGATCGGGTTGCAGGCGGACAAATGCGTGCAGTCTCGGTCGACGTCTCCGACACGATCATCGATGGAAAAGGTGGCCATTACGACACTAGGAAAGCATAC
TGACGAGACAACGGCAGTCGGAGATCGCGATGATCAGCAGCATATGAGAAGCGCAAAACCGAATGACGACGCGATGGATTCTTCGAAGACAAGTGCGATG
GAGAAACAAAAGAATGCGGTTTTGCGGTCGCAAACTGCCGAGATAGCAGTTCAGTGTGACGAAGGTCATTTGTACGGAAACGGAGACGACAGAACTTATT
TCGCATGCCATAGTGCGAGTCCGATCATTCGCATCGAAGGCAAGAAGAGCACCCCAAAGACGCCTTTGAGTGACTGCATCGTGCGCCAAACTCGCCCCGC
CGTCATGCATGACGAGCACAAGAGACGCCGCAACGGTAATGCTCGTCATTCCAGAGAAGCACTGACGTCTAGTGTGTTGACGCGGGATCTGCCGCCTCCT
CTCTTTTTCCAGAAACCAAAGTCAAAGAAATCGTGAGGTCTGGCGTCTGCTCGGATCAGGTGTCGCCGCAGTAGAGCACGATATACGGCCAACCTATCGT
TGGCATGATGATCGCGGTATGTTGTTCAGTTAGTTGCAAGGTTGTTGAACAATTTTGGTGTATGTGAAAAGTCGTTGGACAACATCTTCAAGTGGACACT
CGAGCGAACCGACGTGGACACCCATCTTCACTAGGCGGACGTTTCGGCGCCAAAATGGCTGCACTTTGAAACTGCGCATCGTGGGTCGCCATGCGGGTGT
CGGTTTCTTCTTTTCGGTAAATACGCGTAATTACGCTCGCGCGCAGGAAGGGGCGCGCACACACGTCTGTTCACGCTCATGCGGCGACTCTCGAGTGCTC
ATTCGCTCATTCTTCAACCTTCTCTCTGGGGGAACAGCAGCAGAGCAGGTCGTCCAAGAAGGAGAACGAAGGAGAGCAACAGAGTGCGAGTAGAGAAGAA
CGAAGGACAGAGAGAGAGAGACGAGCGTGGGGAGGAGAGAAGCCAGCGTGCCGATCGAGACTCTCGTGAGAGCGCTGCGTCGACTTTTGTTTTTGTTTTT
AGGAGAGCGAGCAGAGAATGGCCGACTTTCGCCCCGTGCTCAAAGAAGGCTATCTGAAAAAGCGCAGTCGCGACAACGCGCTAATCAAGAACTGGCGGCG
ACGCTACTTCAAGTTGTACGCGAATGAGTTTGTGTACTTTTTGAGCAGCACCGACACGTTGGCGCGCCGCCATGTGGTGCTGAGTCTGGACTCGGTGGTG
ACGCAGACAAACGACCAGGGCTATCCGCTCTGCTTTGCGGTGAAGGCGTCTCCGAGAGAGGAGAACTTCTACCTGCAAGCAGAAAGCGAGCAGGAGAAAG
CGGAATGGGAAACGGCGATCTTTGGCGCAGCGAGACGGACGATCGATGTTGCGCCTGCTCCGCCGTCTCCGAC