Description :
From Genome Similarity Track
Location :
Scaffold_3:180598- 182557
Sequence
1959 bases(100 bases per row)
AAAACGGCGACGAGAGCCCTGAAGATGTTCGTGGAGGATCTGGATCAGAGGGATTGGGATGAGAGTACGCAGAGCGATTGATCTTCGCGATCAACACGGC
TCAAGATCGGGTCCGTGGAGACTCCCCTTGTTATCTGGTGCATGGATGGGACCCTCGATCGACGCTCGAGGCTACGATACCTTTGGGTAGTACCCGGACT
CGGGATCGGGATCCTCGACGGTGGCGGTATCGGATCCAGAAGCACTACGATCCGGCTCGAAGTCAGGTGAATGCTCGACTACGCGAGGCGATTGCGGATC
GGGCCAATCAACACAATGAAGAAGTTCGACCGCACTCGATCGAAGCTGGATCTCAGGTGTGGCTGTACCTGGATCGTGTGAAAGAGGGGTATGCCCGGAA
GCTGGCTCACCTGTGGCACGGCCCGTTCAGTGTGGCGGAGAAGGTGAACGAGTACACGATGAAGCTTCAGATCGCTGGTACGGACTACCACCTATTCCCG
ATCGTGCATGTTTCGAAGCTGAAGTTGGTCAGGGACTTCCCCGATCGACCGCAGATCGCACCCACGGTGGACGAAGCAGATCGACTCGATTTCGACGAAG
TCTTACTTCCGGAGGACAGCTGGGCCCCAGATCGAGACTCGAACGAGTACGAAGTGGAGAAGATCACGGATACGAGAACAGGTCGCAGGACTCGGTATGG
CCGGACGTATCGAGAGTTCCTGGTACACTGAAAGGGTTATGACGAGCCTGACCGGGTCGACGAGGCTGATCTCAAGTGTGGAGCTTTGTTGCACCAGTTC
CTTCGAGATCGCGTGAACCGGAACCGATTTGGTGCGATGCAGTCTCACGAAGAAGAGTGAGATCGGACCGCCAGGGCGAGCTGGTCGCCTTGGTGAGCCA
GGTGAGTGACGGATCGACGGGGAGGCCGTTGATCGGAGGAAGGGGTTTTATATTCAGATCGGATGGTTATGGAGCAACTACAAGGCGCTACGACGACGGA
TCTGGGCTGATCGGGTTGGTGGCGAAAGGTGGTATGACGATGGATCTGGACTGATCGGGTTGGTGACGACGGATTGACTTGAGAGAGGTGGCCAACAGTG
ACGAAGATAGCAGTGGTGTTTATTGATCCGAGACTTTCATGCTACGAATATTGATCCGAGACTTTCATGCTACGAAGATGCGCGATCGGCCTCCAAAAAT
CGAAGATTTCACGACAGACGAGCTGACCAGCTGGACGCTGAATTCGATCATCCGAGCTGGGGGATGCTGTTGTTGCTGCATACACTCTGTATTGGGGATA
AGTTCGTTGAGGAGACAAGCGATCGGCTGTTCCAGACGATCCTGGGGCGGTAGCAACCTTTGGGTCCTGCCGGTGATCGTCGGTGCCCGCCTCGATCAAG
CGGAGTAATAGATTTCACGACGAAGTGTGAGCCGTTGATACTGGGATGGTGAAGTCTTGTCCGCGGTGAGCCGCCGTGGGGCCCGACTTACGGACAGGGG
GCGGTTGTGGTGAAGCACCGAACAAGAATTTCCAACTGCGATGACATCAAGCGACATGGTGGCAGAACGATAGGCAGGGATCAGGCTGCGGTCGCGGATC
AAGAGGGTCTATCGAGAGATCTCAAGCGATTGGATAACGTCGACGCGTAAGGCAACACATATGTCAAGACAGATTACGGGCGATCGCGCTTGGACTGCGG
CGTGATTCTACGTAGACCCAAGCCCGGATCGACGACCAATCTCGCAGATCTAGGGCGGCCGAGGACAGAAGAGGACGGATCGGCAGCGCACGGCAACTCG
CACAGGTCATCGATCGGGAGCCGATCGTAGATCGCCGATCGGGGTCGATCGTGGATTGGGAGCCGATCGTGGATCGCCGATCGGGGTCGATCGTGGATCG
GGAGCCGATCGTGGATCGCCGATCGACCCGGATGGGAAGCATATGGGGGCGAAGCCAGG