Description :
From Genome Similarity Track
Location :
contig_53:180511- 182096
Transcript NameFunction/comments
g10796.t1hypothetical protein

Sequence
1585 bases(100 bases per row)
GATGAGCTGCAGCACTAACGCGTAGCCTAGAAGAATGAGCATGTTGCGAGATACGTTGACGTTTTCCATGCCGTAGCTCTTGAGCAGTTCCCACGCTTCC
TCCGTGTCTTCTCGAGAGAAATGCTCGTACATGAACGACTCGAACGAGTACGTGTGGAAGGCGAGATAGTAGCCCCATTTCCAGTACGCAGGGATTGCGG
AGAACGGCACCATGAAGCCTTCGCAGAGCATGAACATACCGAAGAGACCGGCTCCCAGTGCGATGCCCATGATGTAGTGCGGCACGGCAGCTCCGAGAAG
ATGCATCATCGACTCGGCAGTGACGAGTGACAACGTCAAGTTCAGGAAGAAAGACCCGAACGAATGCACGTGAGCAAAGTACACTACAATGAAGGACGCC
AATACCGAGATAAACGTGATACCGGGCAGTGCACCGAGGAGATTGGCAGTCGTGTAACTTGCGAGGTGCAGCGAATGTGACCGCACTTCTCGTTCCAGCA
CTGCTCGTTGTTCCAAAAGAGCCGGTAAAGCTGCAACGGACATGAACACCAGGAAGGCTTGCACGTAGAAGAGCAGAGGGACCATGGCAGCGCTTGTGAT
TTCCTGGTTCGAGCTCAGGTACATCGTACCGACCATGAACGACAGCAGGATGTACATGAGCACACGCAGCCAGAACACTCCCGGGTGGCGCCAATTGTTG
GTCAGATTCCGTTGCAGCAGCACGCAGAACTGGTCAAGTCTCGAGGGGCGCAAGGCCCGAAGCATCTCGTAGTTGATCAGATTCACGTCCCGCATCGAGC
GATCTCGTGCTACCTCGACACGCAAACGCTGTGGCTCTGACCCTTCCTCGAGAGCTCGAACGAACGGCTCAAGATGCAAACTGGCGTGGAAATCCAGGTT
CACCAAGTGGACGAAGTACTCGGCTGGATTGGAGTACATTGGACACACGTAACCCAAGGAGAAGAAATGTGTGAGCGCTGCTGTTGCTGGACCAAAGTAC
ACCAGTTCGCCGTTGCTTAGGATCACCAGGTTTGTCAGCATTTCGTACACGGAAGACGATGGCTGGTGAATTGTGCATATCACGTTCTTGCCACCCTCCT
GGCAGAGGCGTTCGATGTGCTGCATGACACTACGGGCCGACGAAGCGTCTAGGCCTGAGGTAGGCTCGTCAAGCAGGAGCAACGCCGGATCTGACAGAAG
TTCCACAGCAATTCCCAGTCTCTTGCGCTGCCCAGATGAGATCCCTTTGTGGAAGACATCTCCAACGTTTGCGTTCATGCAAGTCCGTAGCCCCATGGCG
TCGATAACGTCTTGTACGCGTGACTCGCGCGTGAGAGCGGGGACGTGACTTGGCAGCCCAAGGCCTGCCGCGATTTGGAGAGTTTCCAGAACTGAAAACG
ACCCGAGAAATGCCATGTCTTGCGAGACGTAGTTCATGATCGAATGGAAGGTGCGTGGGTTTCGAGGCTGACCGTTCACGTCCACAATGCCCTCGACGCG
TACTCCGGGGCCTCCTGGCGGCACTCGATCTGCGAGGATGTCCAACAGCGTAGTTTTGCCGGCTCCGGACGGACCGATGATAGCT