Description :
From Genome Similarity Track
Location :
contig_30:180509- 201040
Transcript NameFunction/comments
g6548.t1hypothetical protein
g6549.t1hypothetical protein
g6550.t1hypothetical protein
g6551.t1hypothetical protein
g6552.t1XP_002905457.1 mitochondrial-processing peptidase subunit alpha, putative [Phytophthora infestans T30-4

Sequence
20531 bases(100 bases per row)
AATTCTGCTTGTGTGACCTGTAGCTCCATCGAATGAAGCCTTTTCGCCTCCCGAGCTGCTCGAATGTGCAGATTCTCTTCCAATTCGCACTCGACTTCTA
GTTGGGCCATACGAACTTGCTTGTAGTACTCAGCTTCGAGCGCTCGCCGACGAGTCTTAGAGACAAAACCCTCTCGCTGCTCAAATTTAACGAGCGGCAC
AATACGAACTTGCCCTGCAGCGCTATGTGAAGAATACATTCTGGCCACGTTGGTGGGTGCACTCGCACTGGGCTGGTTGTCGGAATCTTCGTCTTCTGGC
AAACTTAATGGATCGAGTTTGATTTTCTTGGTCAAGCCTGCAGCACCGTTGGCAGGGAGTAAGGGCACTGAGGAAACTCTTAGCTTCCCAGTAACAATCG
GTGAGGGAACGATCGTTGTCTCTATCTTGGCACGAAGACGCTCAATTTCCGTATGACATTCCTCAATTTCCACCTCCAGCTCCTGGAAGCGAAGAAATTT
GCTACCACGCGCGTGAGTAAGCCCCATGAAGTACCCACTCGGTACCTTGACCTTTCTTACCTGCTGTACTTAAGCCGGTCTAACTCTTGCCTCCGCTCCT
CAGCAAGAGCTTCAGCTGTCACAGCCTATCTAACCAACGAGATGACAGTAGCCCACAGTGCGTCAGAAGCAGCTTATTAACCACCGCAAATGTTTAGATA
CGCCACGCTACCATACCCGTTGCATGCATTCGGATACAAGACGGTCAATTAGCTCCTGCTTGCGGGTTTTAGTGGTCTTTGCTTCCTGTGGTGACCTCAG
GATCGCAAAGGCAGCGTGCAGCTACTCGCACACATATCGTAAGCCAACATTTACAGTAAACAATGGCACCAAGACAAACGCCTTACGTCTTTGTCTTTCT
TTCGCAGTGTTTCCTGCAGCCTCCGAGTTCCCGTCTTCAACTGTAGAATTAATGCATCCTTTCCAAATACAATCACATACATCAGCCCAGCCTGCCTGAA
CGCCACATTCCTCAACACGAGGCGCCACCTTCTCTCCCAGCTGCCTTTTCACCAGCACGAGCTCCTGCTTGGTGTTTTCCCATTCACGCCATCCATCGTC
CAGCTACCAAACAAATAAGTCAAATTCCACCATATTTCCGTGCAAAGTACATTTTTCTCCACCTCGAGGTGCTGGTAGGGCGTCACCTGGGGTTGGCTAG
CGCTTCCCCCACGCCGACTCATTAACCGCCTCTCCATGGTGACGTACTTGGAATGCAACTTACGTCGTTTCGTGCACCAGGAAATAAAAAAGTGTAGCCA
TGTTTAAAAGCATAGAAACCCGAAACGTCGCGATCTGCCTGTGAGATACTCGACCACATATCGATATCCTATCTCCTGTAGCATGGGGGAGGCACCGAGC
TGGCAGCACATGTGGGGAGCCAAGGTCAAGATGCCCTGCGATATGGAGGACGACGTGCTTGAAGACGCCATCAAGCACGTCACCTCGCGGCTGACCAAGT
ACGACACCGAGGAATGGGAGAAGAACGGTTTGGCGGTGAGGCAGCATCGCTTTGTGTCAATGTGTTGGTGCTTATACTGATGTATTGCTACTGCCAGGTG
TGTGAGGAGATCAAGGCGCACCTAGACGAAGCGTGGGACCCGCACTGGGTGGTGTGCATCGGCCGGAATTTCGGCTCGTTCGTCACGCACGTCACGAGAA
ACTTTGTCTTTTTCTACTACAACGAGAAAGCCGTGATGATCTACAAAGCAGGATGACTGTAGAGTACGGCGAGGACCAACGCAACATCCAGACACGTATA
GTTTGCTGCATTTGAGCGCTTGGTGTCATTATGCGCGAGTTGGCCACAAAACTGTCTGTGTAGGCAATCTAGTAGCTCCATTCATATGTGACGACGAAGC
TGGGGCTACAACGCTTGACACCAAGACTGCACACTGCCGGTAGTAAGAATTGAATCTATCGATACCTCAATGTGAAGCTCGAATTCAAAAGCTCTTCAAC
TAGTGCATGAAGTCACTTCAACTCATGCGCAGTCTGTGATTGGCTGAACGCCCAACAATTCGACCAATCGAAATGCAACGTCTGCAGCCCAACAGTTTTT
GACACAGAAAGCCATTCAAGCAGTCATGGCAACGCACGTCGCCAAGAAGATGAAGCTGGAGCACGAGGCCATCAGCTCCAGCGCCGACGCGAACGCGGCC
ATGAAATCGGAGGACCCAAGCGCCAGTGGCGATGAGGAGGACGAGAACGGCACGTCGGCCATCGCCCAGTTCCAGAGCGAAGACGTGAGCGCAACAGTTG
ACACATTTTACAAAAGCCCTGAGTCTCTAATTGGGTTGCGTTTTGTGCATTGAATAGGGCACCAATGTGGGTCCGCAACTGGAGATACCCACTAGCTCCA
ACGTGCGTCAGATGGAGGAGCTGGTGAATGAGCTGCTGCAGAACGGCAAGAACCGCGTGCCGTACTCGCTGTTCATTGGCGAGACGGAGGTGACGACATC
GCTTAAGGCGACGGTGGAGGAGCTGGTGAGTGGTTGCTGATGTTTTGCACTTTTTGAAACAGGTTGCTGACTGTTTAGTGTGCTGTTTTGGTGGTAGAAA
TTGTCGACGGAGACGGCGCTGACCATCACGTTCCAGCCGCTGGCGGCGTTCCGTGTGCGTCCGGTGACTCGTTGCAGTGACACACTGCAGGGACACTCGG
AGGCCATTTTGCACGTGAGTTTCAGCCCCGACGGAAAGAGACTCGCGAGCGGAGGAGGCGACGCTACCGTTCGCTTCTGGGACACGAACACTTGCATGCC
CAAGCACACGGGTCGGGGCCACAAGAACCATGTGCTGTGTACGGCTTGGTCGCCCGATGGCGCGCGTTTTGCGTCGGCAGACCGCAACGGTGAGATTCGT
CTGTGGGACCCGTTGACAGGCAAGCAGATCGGCCAGCCCATGAAGGGCCACAAGCAGTGGGTGAACTCGCTGACGTGGGAGCCCATGCACCGCAATGCCA
CATGCGAGCGCTTTGCGAGCTCTTCCAAGGACGGATCGATCAAGGTGTGGAACGCTCGCACTGGGCGATCCATCGCCTCGCTGTCGGGCCACACGGACTC
GGTGGAGTGCATTAAGTGGGGCGGTGAAGGCCTGCTGTACAGTGCGTCGCGTGACCGTACCATCAAGGTGTGGTCGATGGAGGGCGAGCACGTGGGCAAA
CTCGTGCGCACGCTGGTCGGACATGGTCACCGTATCAACACGCTGGCGCTGAATGTGGACTACGTTTGCCGGTCGGGACCGTTTGGCCACAATACCAAGA
GCTTCGCGTCGCGTGAGGAGATGCAGGAGGCGGCGCTGAAGCGGTACCAGGAGGTGCGAAAGGGTCAGCCGGAGCGCTTGGTGTCCGGCTCGGACGACTT
CACGCTGTTCTTGTGGGAGCCCGCGGAGAACAAGAAGCCGCTGGCGCGTCTCACGGGCCACCAACAGCCCGTGAACCACCTGAGCTTCTCGCCGGACGGA
CGGTATTTCGCGAGCGCGAGTTTTGACAAGAAGGTGAAGATCTGGAATGGCCAGACGGGCAAATTCATTGCCACGCTGACCGGCCACGTCGGTGCAGTGT
ACCAGGTGTGCTGGTCCAGCGACGCGCGCCTGATCGTGACGGCCAGCAAAGACTCGACCGTGAAGGTGTGGGAGCTCAGTGCCCCGAAGAACGCCAAGAC
GACGCTGTCGGGCCACGCCGATGAGGTGTACGCGCTGGACTGGAGCCCCAACGGCGACATGGTGGCGTCGGGCAGCAAGGATCGCACGATCAAGATGTAC
GTGCACTGCTTCCCTATTGTGGACGTACTTGGCCAGTCACTAATTCTCCGTTTTTTGTGTGTCATCTCGCAGCTGGAAGCACTAAGCTCGAATTTGAATA
GACCTCATTTTGCCTCTCTCCAAGCGAAAGTTTAACGTTAGCCACTTCAAAGGACTACACCTTGATTCAAGGGCTTCCAACCGCAAAATCGAAAATATAT
TTCACACCTATTTTTTATATTTCCGTAAATACATTTCGTAAATAAATGGGAGAGGCGGGATTTCCCGCCAACTACGCCGCTCACTTCGGCTTTAGCGCGC
GGCCAGCACCGACCAACTCTCTTTGCTGCCGTGCATCTGTTATCTCCAGCATGAAGCGCGGCCGCGACGAGAGCTCCATGGAGGACTGCGACGCCCTGGG
AATGACGCCCCCTCCGTCGTCGCTTTGGGCCTCCATGTCGCCCTGGAAGCCGCCACACGCGTCCGCAAAGCGCTGCAGAGACCGCTCCGTGCCCGTCGGT
GCGTGCTGAAACTCGGTGTTTCAACTTGAAAAATGACTAATTTAACATGCTTGTCCTAAACTAAAGACGCGATGAGCCGGATGATGTCGGCCGCCGTCAC
GAACGCGCGCATCAAGCGACACAGCTCCATCGGCAAGTTGTTCGCGCGCTCGGAGACACCGCTGGCCTGCTGCGCCGTGTGCGAGAGCTCCGGACGCCCA
GCCAAGCACCAGCTGCAGCCCAGCCAGACGCACACGTGCTCGCACTGCGAGAGGAGCATGGGCGACTGCTGCCGGCGCGAATGCGACGCGTGCTGCAACG
TCTTCTGCTCGCTGTGCTCGACGCTCAATTGCGACGCGCAACTGGACCGCGTCTTCTGTTTGTCGTGCAGTCTGGAGCAGTCCAGGGTGTAGAGCCTGGG
AGACTACGAAGCTGAGTTTGCAGCTTGCTGTTGTGCAAGAAGGTTTTTCTAATTAGTAATTCTAAAGTGCATGTTTCTAGTTAATTTTTGTATTTAGCAG
CAGAAGGTGAGGTGGTTGTGAATCTAACTGAACATGCCAATGCCAGGTTGGTCGTAGAGGAAGCTGTGCACGATTTCGTAGGAAACCGCGGGCTGATCGT
GAGGAACCATCTACACATATACGAGAGCAGGTTAGTTGGTGGGAGATGCAGGACATGGGGCTGGGTGAACGTACGTGGCCTGCGTTGTAGACTTTCATGA
AGCTAAGTCCGTGCGAGGTGCGGATGCGGCCGATGCGTCGTCCGTCCAAGTTTTGCTCGGTGGAGGTGGTGGAGGAGAACTCTGCTTGGTGTTTCCAGAC
GAGGTCGCGCGTCCACGAATCCTGCGTCATCCAGTTGACGACGGTGTCGGCATCCCCACCGTAGACAAGCACACGAACGCCCTGTTCAAGCGCCCGAGCG
ACGTTCGACTCGCTCTCCTCAAGTCTGTCCATCGGTGCCAATTGCTGAACCGCTCCGAGCGAACACAACTTCCACTCGTGTGGGATTTCGTCGAAGTAAG
CACGTACACGTGGGCTGTTGACGAGGTTTTGGAGACGTTCGAATCGGTAGCACAGCTGAAGAGGGTCGTCCAGGTGGCAATCACGACGCATGTCGTACAC
GTTTCGTCCACGCTCCCAAATTGAAGAGGAAACAACTACACCAAAGTCAGAAAGTATCTGCAGTGCCTCCCCGCAATCAGGGCCAACGCGATCATCAACG
GAATGGCGCAAGTTATTTCCTTGATTTTCTTGTGATTGGCTCCTGCAATTCGCAATAGACACCTTGAAGCGATCGACAGCGTCCTGAAGTGTTTCCTCGT
TTGACCCAAGAAAATTGTAGCCGTAGTCGTTAGATTTCAAGAAAGTAATCGCTGACTCGACCCAGGCACTTGTCGACACAACACCGTTGCCGATTCCAAT
TCCTTTCAGCGTAGGAAGTGAACCGTCATTCTCGAGCACTCTCACCGCCAAGTCCGGAACGTAGTGTCCTGCATAGCTCTCTCCGAAAATGTAGAAGTCG
TTGGCTTTGAGCTCTTGGTGCTGTTGATAAAATTGGTGAAGAAACTCGAGCATGTCTTCTGTAGCCCCACCAAAAGACCAAGGCTGCTTGATTCCATTCG
TCCCACCGCTGTACCCTGTGCCCTTGGGCTGGTCGAGGTAGATAACGTGCGCGAGTCCAGTCCACGAGTACGGATTGAACGAAATCGTGTCTGCCTCGTC
GTCGAATGAACAAGGGCCATTTTCAAACAGTAACGCGACCAAGCCAGAGCATCCAGGCCCGCCCGAGAGCCATAGAATCACAGGAATGTCGAATCCATTG
GAGGACGATTCGTAGAACACGTAATAGAGACCATTGAGGGTTCCGGTCTCCTTGGCGATGTTTTCCCCACACAACGACACGGATGACGGGTACTCGTTAG
CAAGGTCGTTCGCTTGGGCGAACAAGTGCTCACCATCTGAGAACACACAACACCGCGCTATCAATGCTAGCACGAGCAACCACCAAGCGTGGAGACGCAT
CGCTGATAGAGAAATGTAGACGCGAGGATCGAACCTGACGAGTCACATGCGACCTTTGCTGAAGATTGCGACTAGATGAACGGTTGGTGTTCTGTAGTTC
CACTTACCACTACGACACCAACGAAACTAACATCATCAGCGTCCTTTTTCCAAACGGACTCACACATTGGCACAGCAACGGTTAGAAGCCTTCTCCAAGG
TAACAGCCGTAGCTCGTAGCAACTTCTATGCTTTCATTCAATCTATCGGTCTTCATTTTTCAGCTTCAAGCACAAGTACTCCGCCAGACTCCGTTCGTCT
ACAGACCACGTGACGCTATGCTGTTCAAATCAAAAGTAGATCGACTCCATGATGGAGCTGAGAGGGTCGTAAGCGGGGATGAAAACCTCTTCAGCAGGTA
AAACATCTTCGAGGTCTTCTAGCTGCACTTTCTCAGGGAGCAGGATCCGGGCCTTCAGGAAGGAGTTCCGTGGTTCTTCCGCGGTAAGCGTCGTGTAAGT
TGAGAACGGGAGTTGCTTGGGTGGTGCCTGGTAGCAAATACACACATATTACTTTCAGAAGTGCCAGCAAACAATACCCGAACGAAATGCACCACCTCGA
GTCCGGGCAGCTCTGAACCAGCATTCATGGCGCCGTGTGTCGATTTCGTAGTTCGTGGCATGTTTCCAGGAGGTGAAGCTGCACCGAGATGTGGCGCCTC
ACCAACAGCGCACTCTTCGTTTGCAGTCACCGGTGTTTTGTCCTGCGACCAGGTCCCGTTGAAGCAGAATCGACCCAACGAGCCCATCGCACTCTTCTGC
TGCTTGTTAGTAGGTGGTGTTCGCTTCGGTTTATTTCGTTGCTGGTCGACTTCCTCTCCTTCATACGGACGCTTGCCTCTTGGCTGACTCTTGTTCTTGC
GACCAGCAGCCTTCCCTCTTTTGCTGCGGGCAGTGCCCACCTTGGATTCACCAGCGACTGCTCTTTGCTTCTTGCTTGCTGTTGCTGTGTCCTTCACCCG
CCTCGACGGCACTATAGCCTCATTTTGAGCCTTAAATACGGGCGGATGACGCGGAGGCTTCGCAGTAACAGCCTCTGTAGGCTGGTGGTGCTTGACTTGC
TGAAGGAAGCTGTCCATGCGCTGTTGCTTGGCGTTCGTCTGGTGACTTGTAAGCGTCTTAATGTACCGAAGGATGCTACTATCTCCCGAGCTCTCATTAG
GAGCCACTTCCTGCCCACTCGGAGCTTCAAAGGTGCGCTGCACCATCGCGTTCTGCTGGCAACTCGATGCGGAAGAAATGCAGAGTGATGGTATCAACTT
CAACTTGCAGTTTCTTTTAGTAAAATGTAAGAGGTCGCGCTAACTTATCTGTTGAACCACCGCTTCTTCTTAGACTTGTGTCGGCTGTAGACCACTGCGG
CTCGGCGACCCCGTCGGGAAATTGTGAGTGACGTAAGCGCCGAGCTGGGCGCCGCGGAGCTTGGAGGCTTCCAGGAATCCAGCAGGGAATAGCGCCGCTC
GGAGTTCATGGCACTCGTTCCACTCTGCCGACTCAAGTAGGTTGTCGCTTCCGACGGGACCTCCCCTCCGGCTGGAGGCTGCCGGCGAGTTGATGGCGCT
TGCGAGTAGGTGGCGTTGATACTGCTCATGGGGATGTTATTACCTGCAGCAGCAGCAGCCAGTCTGTTGACTGGCTTCGCGTCGACGTCGTCGGGATTCA
AAGGCACACTTCCGCGACGGGGACGTGGCCGGGTAGCGAAGATGTCTTCGTCGTCTTCCTTCTCGTCATACTGGGCCGCTTTCTTCGAGTGGTACTGAGA
GTCAATCGGTTCGTATTGAGCTCCTAGCGTCGAGTAGCGTACCGATGTGGGCGAAGGTAATGGCGAATCGAGTGCCGCTTCTCCCCTGTATCGGAAGCTT
CGCGGCGCAACAGCATCCCCCACCTCGATGGCTCCAGCTGTGAAGTTGATGCTCTTTGGAGGGACCTGGATAAACGTGCCATCGATGTCGATTTCGCGGT
CGTCAGGGATGCCTTTGATGTCGACACGGATAGAAGGCTCACGCTCGCCGTCAACATCAAAACTTCGAGTGCTGTCAACACCTGGCGCTGCTCTTGCTCC
ATCCACGTCGAAACTTTGCGTGCTTAAGATGTCCGGGTCCGCAGAAACTACGTTAGCTGCCACTGGTGACTTCGTTTCCGATTGCCCAGTTTTAATTGAG
CCACGGATGATTGAAGGTCTGCTTTCCAGTGTGAAGTTGTGCCAACGACCCATGAAGCTGCGTGAAATCTGCTTCAAGTGCGTTTCTTTTGGCTCTTCAG
CATGAATGATGCGCAGCACACGATTCACATTGGAAAAGAGTGAGGCCTCGATCTGCTCCTTGTTTTCCAACAATCCTTCCAGGAACGCTAGCGTTTGAGG
GTAGTATTTGAGGTCTTTCAGCCAGAACTCTGGTTCATCCTTCGCCTCGCTTTCTGTAAGTGCAGTGTTGCGTGCCTCCAGTACACGACGAAGAACCTTC
AGCAGGGACGGAATATCTGGGTGCTGCATGGTGATTCGACAAATGAGCAGCTCCATAAAGTCTTTTGAAACGATCTCTGGAAACTGCACCAACCGCCGGG
CAACGCGTAGAATGCAGCGGTACGGAAAGCTTGTGATCAAGTTCTGGTTACAATAACGCACAAGCTTCACGATCTGCTCTGGCATGCGATTGTTGGCAAT
ACTCTCATCAATATCGAGGGATGCCCGCAAGATATGTGTCATAGCCATGGTATACTTGTCGATCTGATCCGCCGTTTTCTTGAGATTGTCGGGAGGATTA
TGAAGATCAAAGCGCATTAAAAGGTCGAGCTCAGTTCTCCACGTTTGAAAAAGCAACTCCAAATTATAGGCTGGGTTCGTTAGCTTTTCTGGATCCGGCC
GGGACAAAAAGCGATCGATGTAGAGACCAGCCACAAAATTCTTTGGGAACGAGATGCAGTCAGTTTCGTCGTCCAGCAGAACGGAGTCTCGTTTTGCTAC
AGACCGCTCGAGCCGATTCCGGCAAATAATGGTGTCAAGCTTCTTGCGAACTTCTGTACGTCTGTGAGAGTTCCAGATCAAGTCGCTCTTTTCGTGGTTA
TCATCGAAGAATCGTGACGCTTGGTTTGGGTCCAAGTGAATTTGGTACACAATTGGGTACGGTAGGAATCGGCAAAGTCCACTGTACATCTTCTCTCGCA
GCTCCAAGTCTTTCATCAGCAACGCATACAGAACTTCAAACGCTGGCGCTCGCAGCGCTTCTGCTCGAAGAAAGTGTTCGTGCAGAACGTGCTGTCTGGA
TTGAAGAGCAATGCCCAATATCTCTACCCAGAGCCCGCTTATTTGTACGTACTCAGCAATGACTAGGCACGTATCACACAGCTCCGCCAAGCAGGAGAGC
GCATAGAATGCTTGCTCATATCCAAGATGGTCCGTGATTACCTGAAGGCACCACGTGAACTGGCAAAAAGGTGCCAGCATTCGCTCTAAGTTGCACTCGA
ACCCGCAGATTTTGTTTAAGATCAGCAGTGCTAGTTCTTGGCGGTTTAAATAGTCCACGTTTCCAAACTCAGCTTCCATTCCTGGGGGTACATCGTCAGT
TTGAGCCTTCGCTTTAAATCCATACGTTGACAACGATCGCCGAGATGATATCGATACACCCTTCGATTTGTCATCGCCATCGAATGGCAACAGATATCTG
CCTAGCGTTGCCACCGATATTGAAGCGTTAACAGGATCTACATCATCAATATGCTGCTCAAGACACTCTACGATTGCGGGCCGAAAAGCTGGCAAATCGC
AAAGAAAGCTTAAGCAATCCAAAGCAGGAAGCGTGTCCGAATAAATACCAAGTTTAGGGTCTCTGTTCTCGTTCAAAAACAAGAACAACGCCGACACAAA
ATCAACGGCTGTGGTTGGGTACAGCATGTCCTCAGTAATTGCTTGAGGGTCCTCCTCCGCCTTCTCCAGTAATATCAGCAGGTAGATTCCTCCAATAAAT
GGCTCTGTACTTAGGCAATCATACATGTGGTTTGCAGCGGTTTCCAGAAACGACACTCCATCACCATTGGGGTCGGTACAAAATTCCTCCGTAAGTTGTG
AAAGTTCAGCTCTTGTGCTTTCGTTCCAAATACACGTTGGCTCGCGTATATCTGACAACAGAATGGTACAAAAGTCATGCCCTTTGGGCTTTTCAAGACA
ATCTAAGAAATCCATTGGAAGCAGATTTGCCAAGGCATCAAGCCCCGCTGATCGTCTATTTCCATCCGGACCCAGAGCAAGAGATCGGAGTGCGCCAAAG
GCACTCTCTAGCATTTCACGCTCTTGTTTCTCCAAAGCGGTGGTAGATCCCTGTGACGTGTCAATTCCTGATGAACTTTCAGCCGATGCCAAAATCAAAT
ACAGACCCTTCCAAAATACCCGTGTGGATGTCATGATTTGCTCCTGAAGCTCGTGGCTCCTGCACAGTGATGACGCAATTTCAAACGACATCTTCTGGAT
ATGCCACGGCTGGATGTTTTCAAATGAAAGAATGACATCATCTAGCAGAGAATAAACGCGATGGGCGTACTTGGACCTGCATGCTCCATTTTGAGACGTG
TACTCCGTCGCGGTAAAAAACGAGTTGTTGTCATCGTCCCCGAAAGTGCTAAAATCAAATACCTTCGACGGTGGCGCCCCGTTGCTTGTATTAGTGCCTC
CTCCTTCCAAAAGCGAGTCCACGCCTTCTTCGGAAGCAAGAAGCAGTTGAAGAATTGAGAACATGCTTTCTTTTGCAGCCACGTCGCGCCCATATGCACA
GCTTTCGACTAAATTGAGAATAGTGTCCCAGCTGCCATCGACTTTTACCAATAGCGGACCATTTTGTGGCGCAACAGAGAGCAATCGCCGCAGCACGCTC
ATCGCCAAACTACGAAATTTGGACTCCCCCGACGATCGAGTCGATAGAACGCGAACGAGTAGGTCCAGCGTCGAAGACTCGTATGAAAAAAACTGGTATC
CAAACTTGTCCAGCAATTGCAATTGTGCCTTCAAAACGCGCTCTATGACTTCGTCCGATGTACGCCCACCATCAGCTACGTCCCTGCGCTCAAGCAAACC
ATTTAGTGAATCGAACGCGTTGCGCACTGTCGTTACCTCGACCTCTTGTTGACACAGTTCACGAAAACGCTGACGCAAATCCGACGACGCGTACGTCACA
TCTTCACTCCACCCAAACACCTTATATGCATCCGAGTGATCTGCATCCTGATCAATCCCATCCGCTTGATGGCGTACCAAGTACCGCCACTTCTCCTCGA
TACTCTTCATGAGGAATACAGGGTCTTCAACCTCCTCTTCAGTATCAGAATTTGACTGATTAAAAGTTGAAAGATAGAACCCACTGCAGTACACGTCTCC
AGACAACTCCAAGAAGGAAATTGGCGGGATTGGAGTGTAGCTGTACCTAACAGCAACACTTTTTCTGAGATCCTCTTTGAAGTCTCGCAGGTGTTCAGCC
AGCATCTCTTGTAAATGCACTCGCATCGTAGATGACCACATTACGCGTTTGTCTTTCTTACGACCAATAAAAACATCGGCAAAGTGTTCAGGTGGCTCTG
AATCCAGAATATTGATGAGGGACTCTGGAAGCATGTCCGTCAATTGACTCTGTCCTGTGTGCAGCTCCGATGATCGCTGAGTACGATGAACTCTTTTAAG
AAATGCTGCTTCTGGAACGAACGCAGGCACTTTGTCCGCTTCTCTGGCAATAGCGACCGTAGACAATATAAAGTAGAAGGTTCCATACTGGTGTAGATCT
TGCAACTCCCCATCACTCAGTGACATCAGCATTTCACACACGTAACGCCGCACGCTCGAGTCATTTACAAGCAGCAGCTGGATCATAAAGGCCAACGATG
ACGCATTAGCTACGACGGTATTCACTAAGGGTGGTGGCCACAAATTTTTGTTTCCAATCGACACTGTGTGCTGATCTTTGATCATAAAGTTCCTTAGCGT
CTTCAAAGCATACGCAGCACATTTCGGATCCATGGGTTCATCAGTCAGCTCCATCCAGCGCAGTTCTGGGTATTCAAACATCGACTTCCACGTATGTTCG
TCGCCATCTGAACCCGTGTGTGTCGAACAGCTACACACGTATAGGGCATCAATTTGGCGGTGCCGAATGAGAGGATCAGCTTCCAGATATTCCTTCAGCT
CGTTCGCCGAGTATGGGCCATTCACCTCACTGTTTCCCTCAGCATCCCCCACTGCCTTAAGCTTTATGCTCCATTTGAGCGCAAACCTGGATTCGTCGTA
CAGGGAAAGCTCTGCAATCGGAACTGAGGAGGTTGCGTCAGCTCCCGACATGACCAGTGAGTCCATCATCGGTATATCACTACGATCGTCCGTTACTTCA
CTCCCTATTGGTGCAGTCCGACGTCTGTGAGACAGCATCGACATGTACAGTAACACTTGAATGTAATTTTTAGTACATAACTCAGCGCAAGCCTCTCCAG
ACAGGCTCAATCCAGATATTAATTCGACGACATCTTGAATTTCACTCGCAAGGTATGAGTTCCGCAGAAGTTCGATGAGAAATCGAGCTCGATGTTTTGT
GATAGGTCGAGCTTCGGGGAACACATGGGCTAACTCGATCAATATTTTCAACATCGAGTGGCCGTGTTGCTCGCTTCCAGTTCCTCCAGTAAAATGCGGA
AATCCGTTGCTTCCACTTGCAGACCAATCGTTAGTTCCAGATAGCGGAATATTGTTCAGATGAAGATGTTCCAGCCAACACTGATAAACCTCGCTGAAAA
ACTTTGCCGGGTCCTTCGCAATATCCATACTGGCGAAGAAAAGGCTACTCGAGTTTTTCAACTTTCCACGATGTGTTCCTGATTCCATCGATCGAACAAC
TTTTGCGACTTCTGCCAACTGCAGAGATCCATCGTTTATTCTTTCTGTGATAACACGGAGGTAAAATCGATCAACCTGAAGCTCTTTGGAAATGCTTTCG
TACCTCACAGAAAATTGTGCGTGATTCCACTTGGGCTCTCTACTTCCTTTACGAGAAGCAACCAAGGATAGTGCAGCGGCTTGGTTAGCTTTGAACTGAT
CAAATTCGTCGATCTCCGATTTGAGAGCAGCCTTCAGCTCACCTCGTGTTAACTCGTTCCAAATTAAGTCGGGGAGAAAAAAATCTTTGCCGACCATACT
TGACAGGAGCGCCATGTCGGTGGATGATTCGCCAGGATAGTTCGTACGGGAAGGTTCCTCCTTGACTCTCGCTTCTTTTACTGACCCACTTGCAAAGAGT
GTCCCGATTTGAAGTTGCATCCGACGGATAAACCACTCCGAGCCGTCAACTTGATCCTGAAGCTGGTGTTTGCTCTTCCGCCTGGACTCTGTTTGCCGAG
CTCGCTGTTTCTTTAGCAATTTCCGTACCATTGGGCTTGAGATCATACGAATGAAACCATGGGGAAGGATCCTCACCAGCATCTCATGAGAGGGTTTGTG
GTGGGTAGCCCAGATGCTTGCGATGTACTGATACGTCTCCTTCGCATTATCCGAGGGGTGAAAAAAAGCCTTGCGCAGGTGTTTAATTGTTAGGCCGGAA
TCTAGCGCAACGTCACAAATGCGTCGCCTCATCTTATGATCACCGTGGTCGACGATCACCTTTAACACGCAAATCACTGCCGCTGCTAATCCTGCATTTA
CACTTTGAGATGCCAACTCCAGCAGCAAGGTATACTTTCCTGCAAGAGCTTTTACCAGAGCATCAAAATGATTATTATCAGTGCTGTGCCGCGAAACGAC
GAGCACATCCAGCATCAGTTGCAGCATAACCAACGTGGAACTTGGATTTCGTTGTTCCAGGAGACCAGTCAGTAGCGAAATAAGCTTATTGTACTCAAAT
ACTTGAAATCGAATGTCCTTCTCAGCCGCCCGATGCGAATTTGATCGGGATTTATCAGCAACCAGCGAGTGAAGTGCATTCACGGCCCACACAGTTGCAA
TCGGGTCACCAGAGACCAATACTTGAGCCAGCGTTGGAACTATTGTCACAGCACCGCCGTTCGACTGCTCCATTGTAAACCGATAGCATCCATCATTAAT
GCGGCAAAACGTTTCCAAGATAATACAAACTTCGTTCGCGCGAATTGGTGGCTTGCAGGAGTGTTCAAGCTGCACCGAAGCCATAATAAACAAAATGTTA
GAGGTCTAAACAACAAAATACTACGCATAAGTGCAATTCAGGCCCACTTACCAAATTATTTACCCCACGAAGCAGGGACCCGAATGAAAGCTTTTCCAAA
CGACCGCGCATGGATTTCCCTGCAAAATCATTCGTCTCAACATTCATATTCAAGCTCTCGAGCGCAAACGTGATCCTGTTAGTCGCAGACGTGATACTCA
CGCCTTCCCCACCCATTGTTTCAATTTCTTTTTCCAGAAGTACGTGAGCAGGAATGTATAGTCCGTCATGGTTTAGATAGAGAAAGTTCTCCTGCTCGTC
CTTTAACAGTGCTCTGGGAGACATTCTCGGGTTTAGGTTGGGAAACTCGCGACTAAGCGACACATTAAAATTATCGACATAGCGATATCCGTCATACAGC
GCTGCCAGAAATTTTTCAACATCGTATGGAACGTAAACCACGCGACTGCAATCCGAAAATTCCAACGCTACCATAGCCTGAGCGTCAGTGCTGTCTAATC
CAGGGGTTACAACCCGCCGCAAATTCTTGAGGTCGTACGTCTTTTTCGAGCAGTCAGTAAGCTCCTGAATTGTTCCATGTACGAAGCACAGCTTCTTTTT
CCGCAGATGAGTAGATCCATGTCGACCTGTTCGTCTTTGAACGTCAAAAACGTCACTCGATTCAAGAGCACATTGGTCAAGAGCCTTTTCAATGGATTGT
TTCGGCAGCTTGTCCCGAGTTTTGAATCGTAGATGGATGCCAATGACACCAGCTAAGGTCTTCATTTTCGTCACAATATCATTGCTTTGGTCGGAATAAA
TAAATTTTAGCTTTTTCTTTGCGGTCAGTATGAACGCGTCTGGGATGCTCGCGGCCTGCGTTATTTCTTCGATGGTGCGGTATTCAAATTCATGAGTGTG
TCGATTTAGAACCCGAACAGCGATTAGAGCGCGTGGTGTCAGATAAAAATTGGTCTTTTCTCGCTGTCCATCTGCTGCACCAATAAAGCCGCTGAACTGG
CAGCAGTCTACGCTGTACACGCGTTTGAATTCCTCAAAGTTACCCACCAAATGACTCATCAGCTCCTGCAGAAAATTATTTCGACATCGGTAGCGGAGGC
GTAAAAATACCGGGTCATCGTATTGATCAATGCCCATCTTCAGCGACCCGCACGCAGATTCGAGAAACTGCCGATACTGCCGCAGCAGTACTTCAGGATT
CTGAACCACTACCATGCTAGGTGCAGTTCCATCATTACCACTTGATAGCGACTCTGACGACGAAAATGTGTTTCGGCTGGACGAATAGTTGTTTCGTCTA
GACGAAAAAATGTTTGGATGACGAGAAAATGGTGCGACGGCTCCGCGTTGGCTGTTAGGCCCGAAATTCAACGTTTCTCCGAAACTGAGCGTTTGCCGAG
GAACTTGCCCGTCATTGGACCGCAATGGGGAACCCATATTACCAAAGTGCAAAAATGCTGGGGTTTTCGTCATCCGGCTCAAAATGCCGACGCACGCTTC
CACTGTCGCCAAGCCAGGAAAGCTGAAAAGAATTCGAAGTATCATTCGGTATTTCGTTGCTAGGTGTTGATACAGCGTTTCAGACAGTTTTCGCTGCTTT
TCGATGTTTGCCTTGACCAATAAAAGAATAAACTGGCACAGCTTCATTGTCGGTAGGTCGGATAAGAAAGACCTCGTCTACATAGCAAAGCAAACTCGTT
AGAACACACATCGCTAAGGCCCAAACATTTTTCGACGTACATGAGTGTCTTCATCTAACAATGATAGAAGTGTCATGACGAAAAGACTATTTGATAGCAG
GAGCTGCCGACACGGCAGCTTATGCGCCTTGGACTCCATCAACCGGCTCAAGACCATGAACATCCAGTAGATAGCCACGGAGTTCTTGCTCACCAATATC
TTCGATATCATGATCATGTACTCTTCTCGATGCTAGATTGAAAGCAAAAACAAATGAGTAAATTAAATGATACCTCGCACGACATGTGAATGCGGCGGTC
ACATGTACCTCTGTCAGAATTTGCATGAACTCGTTGATCGCAGGCGGTGCAAGCATCAACCGATAGAGTGACTGGAGATACGTGATCACAAAATCCTGAT
TTGCTCCGTGACGTTTTACAATGTCATTGAGCTCACGTGCAAGCACATACAGCACCCTCTCGAACGGTTTGTTCGGCTGGGCAATGACACCAGAAGTCGG
CGTATTTGCGTTTAGCTCCGCCGCCAAAGAGTGCATCTCTTCGTCGAGACCTCGAGGAAGCTGGCGCTGAAAGCGCTCTGTCTTACGATGGCCATGTACA
GACATTAACTGCAGAATGGTTGCCTGGGCAACACGGAGCTCGCGATCCAATACGTTCACATTCGGCACAATGTTCGCGATCTTGTTGCCTTCCTGCAATA
TTATCTTTCGCGGTATCATACGCACCCAGTCCGGAACCTCCATGACCTCCACGCCCACTTGGTAATTCCCTAGTGCATGACACGACGCCAAAAGTTCGCA
TACGATCTTCTCGCGCTGGGCAGAATAGTATTTGCGCTTGATGCCATCCACGTACACGACTTCAAACGCCTGCAGCGTGTCCTGGTACATGATGAGGCTG
TAAATGCGCGACAACGGGCGACTGGAGATCACCGTCGTGGCGTCTACGTATTCCGTAATATACTTTTCCGAGACGGACAGCGTCCGTGGGGCAGCGCTGG
ACTCGTTCGACTGCGACACTTTGAGCACTTGGTACTCGAACGAGACACTGGTGGTCGACGAATCTTTCCCGTCATCTTTGAGCGCAGCCTCGATGGTTTT
CTTGCGGTACTCGTTGATCTGCATACCGTAGGCCTTCATGACTCTGTCGATAGCCTGCGCCAGCTCTGTGCGTCTCGGCACAATAAACAAACTCGAGTTG
TCCGAGTGGTTGAGCGCGATGGCCTCATGGTCGTCGCAAATGAGGTCTATCGAGACCAAACTCGTGTACGGGATGTGGCTCATGAGGTCTCCCTCCGTGT
CCTTCTGGTAGATGCCGTCCGGTCGCACCTCCACCACGCACGTGGACTGCACACCGCCCCTGTGGCACTTGAGGCTCTGGAACGCGTGCGTCTGCAACTC
CAATGGCGGCGGTTGTCTAGCGTCGGGCGCCTTGGCGTAGTGTTGGCTGCGCAGCCGCATGAGGCAGACCAGCACCTCCATGCGGAAGTGGCAGCGGAAG
ACCGTCTTCTTGATGCGGTGGCGCGGCGTGTGGATGACCAGGTCCGTCTCGCCCTCCAGCACGTTGGCACCGTCCACGTCCTCGTACGGCCACGTATTGG
TCACGTGCTGGTTCTCTCGGTCCAGCGTCCAGAACGAGTACTCCCCAAGGCACAGCACACGCTCCTTGAGCACGAAGCTCCCGACCTTGTGCACCATGAA
GCGCGCCACAACGCGCTTCATCTCCATTGTCGAAGGTTCTCCCCCGCGCTCTCTCGCTGTGAAATTGCCTTCTGCCGCCTCTGGATTCTTCGTACGCAGC
TCGATCTTGCTGGCCAAAACACTTAGTGACGGCAGAGAGCGTCGAAAGGTCGCGGATTCTGAAGTACAAGGGTTGTTCGTTGAAGTACGATGGTTGGAGC
AACTTTGTGTGGCGCAACTTAGCAACTACAACTTGCCTTTTTCGTGCTTGACTTGCTGTTGCGTACAGCTCTGCGGTCGATTTCCGTGCTGAAGGAGGTA
CCGACGAAAGAGGTGCGCATTTCGATAGCAAAGGAACCCTAGACTGTGGCACGTAGAGTAACACTGATAGAGCCGGCTTCGGCACTGTAAATCAACTTCC
CCCAGAGATTGCTTTAGCGCTGCGCGCAGCAACAATAGTTTTCCACGTGACAATGGACAAGCAAATTTGGACTGGCCGCAACAATGAAGCAACTTTGTGT
ACTAGCAGGAGCGAGATCGTTTAGAGGCGTCGTGAACTTTGAAGGAACTCGCGTTGTGCTCTGTACTATCCGCTTGGGAATGGACGCCTGAGGGATCAGC
ACAATCATGCTCTTAGACTTCGTCATACTTTCCACTATTTCTCCGTGTGTGGCGCCGCTTATATGATGTTTGATCGTGCTTGTAGATTTCCACCGCTCTT
CAAAAATAAGCGAGTGATCTCGTCGTCGTCTGGACTCGAACTGTATCCTTAAGTACGATACCCGTTTAAGTCCGTGTCTTATTGCCTTGAGATTGTATGG
TTCTTACTAAAATCAAGTCTTTCGCGGGTTTTGGTGGTGAGCGGCTCGATGTGCGGCTCTGGGGCTCTGAGCACAGAAACGCGTTTGGCGCTGCACCCCC
ACCAAGTCCCTACCAAGATGCTCGCGTCGTCGTCGTCCAAGCTCGCGGCCCGCGCGTCGCGCTCGCTGTTCACCAAGGCCAGCGCCATGCCCAGCGTGGC
CCTGAGCGAGGAATTCCCGGCCGTGCCCAAGACGCAGCCGCAGGCCACGGCCGCGCCCAAGCTGACGGCGTCCAAAGCCTCGTCGGGCTTGGCATTGGGC
TCGGACGACCGCGCGGCCCCCGTGGCCACCATCGGCGTGCAGCTCAGCACCGGGTCACGCGACGAGAGCGAGGACACGGCCGGTGTGTCGCAGCTCTTCG
CCAAGATGGCCTTCCGTGCCACGGCGACCCGCTCGGACCTGCGTCTGTACCGCGATGTGGAGGCCATCGGCGGCGTCGTGCACGCTCAGGCCGGCCGTGA
CTTTGTGCGCTACAGCGTGAGCGTGCTGCCCGACCAGCTGGAGGCGGCCGCCGAGATCCTGGCCGAGACGACGTTGGCCCCCAAGTTCGCGCTCTACGAC
GTGGACGAGCAGAAGAAGATCGTGCAGGCCGAAGTCGACCGGATCGGTGATGATGCCTCGGCGTCGCTGCTCGAGGGCCTGCACGCCGCCGCGTTCTACG
AGGACCTGACGCTGGGCCGCCCCGTGGCCGCCGCGGACAACCTCCAGGCGCTCAGCCCCGAGGCGCTCTGGGCGTTCCACGACAAGTACGTGAACACGGC
CAACGCCGCCCTCGTGGGAGCCGGCGTGAACCACAGCACGCTCACGGACCTGGCCAACGAGTACTTCGGCTCGTTCGCCAAGGGCGTCGAGGCCGCCAGC
GCCACGGCCAAGTACGTGGGCGGTGAGACCCGCGTCAAGAAGGCAGCCAAATTCACGCACGTTGCTCTGGCGCTGCCGACCGTCGGCCGTGACTCTGCTG
ACTTTGGCGCCTCGCAGGTGCTGCGCGCTCTGCTGAGCTTGCGACTCAACAACAAGAAGGCGTCCGCCTTCCTGTCCAGCTACAGCGACGCCGCGCTCGT
GGGTCTGTCGGGTTACGCCGTCCACTCGGAGGCCGGCGCCCTGGTGGACTCGTTCGCCGCTGAGCTCAAGAAGGCTGCGTCGGCTCCGGCTACTAAGGAG
GAGCTGGCCGCTGCCAAGACCACGGCTGCGCTCGAGGCTCTGGAGCAGTACAGCACCCAGACGGGTACCCTTGGCCGTGTGGGCCTCATCGCCACCACTG
GCTTCGTGTCCCAGTCGCCGTCGGCTCTCGTGGAGGGCGTGACCGCCGCCAAGCTGCAGGAGCTGGCCCAGAAGGCTCTGAAGGCCACGCCGTCTGTGGC
GGCCATTGGCAAGCTGTCGGCCGTTCCCCACGTGGACGCGGTGGCCAACAAGCTGCAGTAAACGACCAAGACGATCGATCAAGAGTGAGGTACATACATC
AGTTTAGCACTCGGAGCTTTTGGTGATGCACGTTGAAGTGACCTTGGCGTGAGTGCGGATGAACAGGACAAGACAGGAGCGTTGGATGTGGAAGCAGCGC
AGAGACGCGGTAGAAACCTCGAATTAGGAAGGGGGCATACAACGCTGGCGAGAGGAGAGGGCTGCTCAGACACACTCGTAACGCGAGGTGACCGATCGTG
CGAATATCGCACTAAATGCAAGAAAAAAGAACCAACTTTTTAACGACAAATGCTCGGTCAGCGGAAGCCGTTGCTGTGTTTCTGACAGTTCGATTCAATC
GCGCAAGAGCTGGCAAACGGCTGTAGCAGGA