Description :
From Genome Similarity Track
Location :
Scaffold_78:180504- 188652
Sequence
8148 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTCCAGCAAGCTTCTGGTACAAGA
ACATAAGAGGATTCTGTCATCCAGTCAACTTCGTCAGCCGGACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCGCTCCT
GCGCGTGTTGGATCTGAATTACAACCTGCTGGTGGGAAGATCCATCCGGATCCTGACCCCGACACTCTACGTTAGCCTGGCTGTTCAAGTCGGCCGGGTT
ACAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTCGCCTTGGACACTGGAGATTGTGAAATGTTCGAAAGGGGAAGACGAGATCCTGGGAGTCTTGGCC
GCGAGCATCACTCCTCGAGCTAAGATGGATGAGGCGCTGACTAGGGTCGCTCCTAAGAAAAAGCCCAAACGCCGGATTCAGATCCCGATCCCGACGGTAC
AGGCAGATGAGGATCTGTACGTCCTGAGTTTCGATGGATCCGCTCGCGTACGACGCGGAGGCGGGGCGTACAGTGCAATACTGTGGAGACTAGCTGGATG
GGAAGTTGTACGGGCCAGATCCACTTATGCGGAAGGCCTCACCGTCAACGAAGCGGAGTATAACGGGCTACTGCTGGGTTTGGATCTACTAAAGGGACAA
GATCCAAAAAGGCTGGTGATTTGTGGGGATTCAAATTTGGTGATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCCCTAACACTGTTACGGC
AGAAAGTGATGATCCACCTGCGTGGTTGGATGAATCACGAGTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCGGATAGCCTGGCCAGCGCCGCTTT
ACGGAATCAATGTGGTGTTGAAGTGGAGAGAGAGGCCGAGCATCAGGATCTCGTTTCGTTGAACCGACTAGACGAAGTGGTGGTAGTGGGATCCAGGAAA
AGGACAGTCCAGGTGATGGCCGTCACTAGGTCCAGAGGAAGGATTGGATCCAACCCCCAAATTCGCGAGGAAACATTTGTGAAGAGAGTCCGCATCGAGC
GGATCCTCAAAGCACAGAGCGAGGAAGCGTGGATCCTAGGTCTAAAGAAGTATCTGATGGGGAATGTACGAGACCTGAGTCGGGAAGATGCCAAATCCTA
CAGCATTATCGCTACGGATTACGCGGTGGATCTGAATGACTTGCTCTTCTATTGCCCCCCTACGAAGAGAGTCAACGAGGATCGGGATGGATTGATGAGA
ATGGTGATGCCGGAAACCTTACAACAGGATGTCCTACACCACTATCACGCTAGCTTGGAAGGCGGACATCAGGGTATTGGTCGGACCTACCAACGGATCC
GGGAATGTTTTCACTGGAGGGGACTATTCAAGAGCGTACAACGGTATGTCGGGGAATGTGTGGATTGTAAGACGGGCAAGGGCAGGCCCACAATCGGAGG
GGAATCACCTGGAAATATCCAAGCGACTTACCCTTTCCAAATCATAGCCATGGATCATATCCCCTCGTTGCCCAAGTCGCTCAAAGGAAACACAGAATTG
TTGATTTAGGTGGACCTGTTTACCGGATACGTGGTAGCCCAAAGCTAGTGCGTCTAGAACTGCGCAGACCATTGCTGAATCGTACGAGGAGTGCGTTTTC
CGAAGATTTGGAGCTAGCGAGATGATTAGACATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCATTCAACCGGATCCTGGGGCAGCGACAGC
GAGCAACCATGGCATATTGTCCCCAAGCTAACGGGTCGGCCGAGCGCATGGTACAGACGATCCTAGAGCACTCAAGATGTACGTCCAGGATTTGGATCAG
AGGGATTGGGATGAGTACGCAGAACGGCTCTCCTTCGCGATGAACACCGCCCAAGACAGGATCCGGGGTGATACCCCATTTACTTGGTACATGGGTGGGA
TCCCAAATCCACCCTAGAAGCGGCCATTCCGTTATGCAGCACCACGAAGAGAAACCGAGATCCAAGGCGATGGCGATACCAAGTCCAGAAATACTACCGG
CAAGCTAGATCCCAGGTGAACGAACGACTGCGGAGTGCGATACAGGATCGAGCGGATCGACACAACGAAGACGCCCGTCCACATCAAATCCAAGTGGGAT
CGCAGGTGTGGCTTTATTTGGATCGAGTGAAAGAAGGGTACGCCCGCAAATTGGCCCATCTATGGCATGGACCGTTCCGGGTGAGCGAGAAGATTGGAGA
ACATGCGGTAAAGCTGGAAACGGTAGGTACCGAATATCGCCTGTTCCCTGTAGTACACGTATCCATGCTGAAGTTGGTCAAAGAATATCCGGATCGGCCG
CAGATCCGTCTTTCGGTGGATGGATCCGATCGCGTCGACTTCGACGAAGTCCTCCTACCGGAAGACAGTTGGAATGTGGATCTCGAAGCCGACGAGTTCG
AAGTCGAGAAGATCACCGATATGAGGTCGGGGAAGCGAACTAGATACGGACGGATTTACCGTGAATTTCTAGTGTATTGGCGTGGATATGACGAACCCAG
TTGGGTAGACGAGGCAGATCTGAACTGTGGAGCATTACTCTATGATTTCTTGCGGGATCGTACGAATCGTAACAGATTCGGCGTGATGCAGTCTCATGAA
GAAGAGTAGGAAGGGGATCCGTTGATGTGAGTTGGTCATATCGATGGGAGGATGAAGAAGGACCCACAGGAAGGGTGTGGGCCAGGAGGAGGAGGATCGC
TGATGTGAGTTGGTCACATCGGAAAGAAAGAGAAGACGGATCCACACGGAAGGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAACCCGGTGCTTGGAGACGAATCGCGGAACGCACGAACGAATA
CCCCGAGTCGCCCACGCACATCACCCCTGAAGCTAACCGGATCCACCGGTGTGGTGGCCAGCGCATCCCACGGGGCAGCTCTTGTCAGTTCTTCCACAAG
GGGTCTGGTGATGAGCGAATCCACGTACCCGGCCCACGGGATGGCGTCTGCTGTCCGAGGAAATATCCATTCAGCTCGAAAAGGCAGCTCAGGGAACAGG
ACCGTGATCTTCATTGAGATGACCGCGACCCGGTTCAACTTCTTGGCGGACCAAGGCTCGATGTCTCTGGTAGCGAAGGCCACAGGAGCACGTCTACTAG
GAATGAAGGCGGCATCCGGACCGAACGGAGCCACGAGGAGCATCCCTGGCAGTGACGAGTTAGGGGGAGCGGGGATCAAGACAGATCCAGGGGATTCGCC
ACCATGAGATGATTCCGGGGATTCGCCACCATGAGGCGATCCTGGAGATTCACCACCATGAGGTGACCCCCTCCACCAAATCCGGGGGATCCGCCACCAG
GCGACCCCCCTCCGCCAGATCCAAGGAGTCCGCCACCACGAGGCGACCCCCTCCCACCATCGCTACCCGATCCACCATCACTGTCGACTTGGATCGCAGA
TCCCGCAGTGTCGCCTCCGGATCCGGCTGTGCCAGCGACTTGTGGAGGCGGCGTCGAGAGGGATCTCCGCCGGGCTTCGGATCGGGATTGGGACAGAGCC
CGTCGCGTGTCTTTCTCCAAGGCATCCTCAGCGGCTCGAGCCTCCTCCAAATCCTCTGGACTCTCATCGTCATCGTCGTCGTCATCGTCCTCATCGCTCA
GAGTGAAGGGATACGGGCCGGAGGACGACGTGCGCTTTGACGACGATCGGTTAGGAGGCCCTGAGCCGTCGGACCAGTCCGACTCTTCATCCTCGTCATC
CTCCGAGCTGCCATGCCCACATCCCGGGGGATGACACGTTTAGCTTTCCCCTTCCCGGATCCAGCACGAACGGGCGGATGGCCGGTGGAAGCTGGCCGGA
GAACGGTGGGCGTCGTCACTGAAGGGGCAGCGGTGGATCCCGACTGAGACTGTCCGGATTTAGCCGTGGATGGGGCTGACCCCGTCGTAGGATAAGCGAT
GGCTGTGGATCCAGTGGACACCACTGCCTGGGACGACGGCGCAGTCGTGGATCCAGTATTGGGCGATGATCCCGACTTGGATACAGCAACGGATCCAGCC
TTGGCAGTTGATCCGGACTTGGATGCCGAGGATCCCGCCTTGGACACCACAACGGATCCAGTCTTGGGTCCGGATCCGGTTTTGGACGCCGTAGATCCAG
TCTTGGACCCAGATCCAGTCGTGGATACTGAAGTCGACTTGGATGCAGTGGTAAATCCGGTCTTGGATCCGGCTCCAGATTTCGAGGGAGAGGCGGAAGT
TTTGGACGTGGATGTGGGGCCCGTCTTGGAGGCGAATTTGGAACCTGCCTTGGGAACGGATGTAGGTCCCACCTGAGAGGCCACCTTAGAGGCCCGAACT
GGGTTTGGATTTGGCCTTTGGGGAGGCTCGGGCATGCTTTGTGAGGGACGGGGGGATCCTGTGCTAGGAGCAGGAGATGCACTACGCGAGCGTTTTCGCA
AACTGACGGATCCGCCTCACTTACAGACGGAAGAGAAGCAGAAGGCGCTGGCCAGCACGAGAGGGTCCCCGACAAGGAAGGGAGGGGATCCGACTCTGCC
AGCTGTCACCAGCGCCAGTCGGTCAAGAGGCTAATCCCGGTTACGGATAAGCTACGATCGTCGCTCAAGAAACAGCTGTTTGCTTGCTGAGTTTGGGCTG
GCGGCGAGGTGATTCCTGGCGCATTCGCGGGGGTCGACATTCGGCTTCCTTCAATTTGTCACCTGGGATTGACAATAACAAGNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAGATAATACAGCTGGGATGATGGGTCAAGGAAAGAAGGGACATGCAGCCGAGCCTGGTAAGGGA
TTTAGCAGATGAAAGACATAGAAGGTAGAAATCCAGGCAGGTATAGGCTTAAATATCAATACAGTCCTCAATTTGCACAGTATCACGCAAGTGCCTTCCT
GCCCTCAAGAACCGGAACTACATTGGCCGTACGAGCTAGGAGAAGGTT