Description :
From Genome Similarity Track
Location :
contig_30:180503- 201034
Transcript NameFunction/comments
g6254.t1hypothetical protein
g6255.t1hypothetical protein
g6256.t1ETI38583.1 hypothetical protein F443_15733 [Phytophthora parasitica P1569
g6257.t1hypothetical protein
g6258.t1hypothetical protein

Sequence
20531 bases(100 bases per row)
AATTCTGCTTGTGTGACCTGTAGCTCCATCGAATGAAGCCTTTTCGCCTCCCGAGCTGCTCGAATGTGCAGATTCTCTTCCAATTCGCACTCGACTTCTA
GTTGGGCCATACGAACTTGCTTGTAGTACTCAGCTTCGAGCGCTCGCCGACGAGTCTTAGAGACAAAACCCTCTCGCTGCTCAAATTTAACGAGCGGCAC
AATACGAACTTGCCCTGCAGCGCTATGTGAAGAATACATTCTGGCCACGTTGGTGGGTGCACTCGCACTGGGCTGGTTGTCGGAATCTTCGTCTTCTGGC
AAACTTAATGGATCGAGTTTGATTTTCTTGGTCAAGCCTGCAGCACCGTTGGCAGGGAGTAAGGGCACTGAGGAAACTCTTAGCTTCCCAGTAACAATCG
GTGAGGGAACGATCGTTGTCTCTATCTTGGCACGAAGACGCTCAATTTCCGTATGACATTCCTCAATTTCCACCTCCAGCTCCTGGAAGCGAAGAAATTT
GCTACCACGCGCGTGAGTAAGCCCCATGAAGTACCCACTCGGTACCTTGACCTTTCTTACCTGCTGTACTTAAGCCGGTCTAACTCTTGCCTCCGCTCCT
CAGCAAGAGCTTCAGCTGTCACAGCCTATCTAACCAACGAGATGACAGTAGCCCACAGTGCGTCAGAAGCAGCTTATTAACCACCGCAAATGTTTAGATA
CGCCACGCTACCATACCCGTTGCATGCATTCGGATACAAGACGGTCAATTAGCTCCTGCTTGCGGGTTTTAGTGGTCTTTGCTTCCTGTGGTGACCTCAG
GATCGCAAAGGCAGCGTGCAGCTACTCGCACACATATCGTAAGCCAACATTTACAGTAAACAATGGCACCAAGACAAACGCCTTACGTCTTTGTCTTTCT
TTCGCAGTGTTTCCTGCAGCCTCCGAGTTCCCGTCTTCAACTGTAGAATTAATGCATCCTTTCCAAATACAATCACATACATCAGCCCAGCCTGCCTGAA
CGCCACATTCCTCAACACGAGGCGCCACCTTCTCTCCCAGCTGCCTTTTCACCAGCACGAGCTCCTGCTTGGTGTTTTCCCATTCACGCCATCCATCGTC
CAGCTACCAAACAAATAAGTCAAATTCCACCATATTTCCGTGCAAAGTACATTTTTCTCCACCTCGAGGTGCTGGTAGGGCGTCACCTGGGGTTGGCTAG
CGCTTCCCCCACGCCGACTCATTAACCGCCTCTCCATGGTGACGTACTTGGAATGCAACTTACGTCGTTTCGTGCACCAGGAAATAAAAAAGTGTAGCCA
TGTTTAAAAGCATAGAAACCCGAAACGTCGCGATCTGCCTGTGAGATACTCGACCACATATCGATATCCTATCTCCTGTAGCATGGGGGAGGCACCGAGC
TGGCAGCACATGTGGGGAGCCAAGGTCAAGATGCCCTGCGATATGGAGGACGACGTGCTTGAAGACGCCATCAAGCACGTCACCTCGCGGCTGACCAAGT
ACGACACCGAGGAATGGGAGAAGAACGGTTTGGCGGTGAGGCAGCATCGCTTTGTGTCAATGTGTTGGTGCTTATACTGATGTATTGCTACTGCCAGGTG
TGTGAGGAGATCAAGGCGCACCTAGACGAAGCGTGGGACCCGCACTGGGTGGTGTGCATCGGCCGGAATTTCGGCTCGTTCGTCACGCACGTCACGAGAA
ACTTTGTCTTTTTCTACTACAACGAGAAAGCCGTGATGATCTACAAAGCAGGATGACTGTAGAGTACGGCGAGGACCAACACAACATCCAGACACGTATA
GTTTGCTGCATTTGAGCGCTTGGTGTCATTATGCGCGAGTTGGCCACAAAACTGTCTGTGTAGGCAATCTAGTAGCTCCATTCATATGTGACGACGAAGC
TGGGGCTACAACGCTTGACACCAAGACTGCACACTGCCGGTAGTAAGAATTGAATCTATCGATACCTCAATGTGAAGCTCGAATTCAAAAGCTCTTCAAC
TAGTGCATGAAGTCACTTCAACTCATGCGCAGTCTGTGATTGGCTGAACGCCCAACAATTCGACCAATCGAAATGCAACGTCTGCAGCCCAACAGTTTTT
GACACAGAAAGCCATTCAAGCAGTCATGGCAACGCACGTCGCCAAGAAGATGAAGCTGGAGCACGAGGCCATCAGCTCCAGCGCCGACGCGAACGCGGCC
ATGAAATCGGAGGACCCAAGCGCCAGTGGCGATGAGGAGGACGAGAACGGCACGTCGGCCATCGCCCAGTTCCAGAGCGAAGACGTGAGCGCAACAGTTG
ACACATTTTACAAAAGCCCTGAGTCTCTAATTGGGTTGCGTTTTGTGCATTGAATAGGGCACCAATGTGGGTCCGCAACTGGAGATACCCACTAGCTCCA
ACGTGCGTCAGATGGAGGAGCTGGTGAATGAGCTGCTGCAGAACGGCAAGAACCGCGTGCCGTACTCGCTGTTCATTGGCGAGACGGAGGTGACGACATC
GCTTAAGGCGACGGTGGAGGAGCTGGTGAGTGGTTGCTGATGTTTTGCACTTTTTGAAACAGGTTGCTGACTGTTTAGTGTGCTGTTTTGGTGGTAGAAA
TTGTCGACGGAGACGGCGCTGACCATCACGTTCCAGCCGCTGGCGGCGTTCCGTGTGCGTCCGGTGACTCGTTGCAGTGACACACTGCAGGGACACTCGG
AGGCCATTTTGCACGTGAGTTTCAGCCCCGACGGAAAGAGACTCGCGAGCGGAGGAGGCGACGCTACCGTTCGCTTCTGGGACACGAACACTTGCATGCC
CAAGCACACGGGTCGGGGCCACAAGAACCATGTGCTGTGTACGGCTTGGTCGCCCGATGGCGCGCGTTTTGCGTCGGCAGACCGCAACGGTGAGATTCGT
CTGTGGGACCCGTTGACAGGCAAGCAGATCGGCCAGCCCATGAAGGGCCACAAGCAGTGGGTGAACTCGCTGACGTGGGAGCCCATGCACCGCAATGCCA
CATGCGAGCGCTTTGCGAGCTCTTCCAAGGACGGATCGATCAAGGTGTGGAACGCTCGCACTGGGCGATCCATCGCCTCGCTGTCGGGCCACACGGACTC
GGTGGAGTGCATTAAGTGGGGCGGTGAAGGCCTGCTGTACAGTGCGTCGCGTGACCGTACCATCAAGGTGTGGTCGATGGAGGGCGAGCACGTGGGCAAA
CTCGTGCGCACGCTGGTCGGACATGGTCACCGTATCAACACGCTGGCGCTGAATGTGGACTACGTTTGCCGGTCGGGACCGTTTGGCCACAATACCAAGA
GCTTCGCGTCGCGTGAGGAGATGCAGGAGGCGGCGCTGAAGCGGTACCAGGAGGTGCGAAAGGGTCAGCCGGAGCGCTTGGTGTCCGGCTCGGACGACTT
CACGCTGTTCTTGTGGGAGCCCGCGGAGAACAAGAAGCCGCTGGCGCGTCTCACGGGCCACCAACAGCCCGTGAACCACCTGAGCTTCTCGCCGGACGGA
CGGTATTTCGCGAGCGCGAGTTTTGACAAGAAGGTGAAGATCTGGAATGGCCAGACGGGCAAATTCATTGCCACGCTGACCGGCCACGTCGGTGCAGTGT
ACCAGGTGTGCTGGTCCAGCGACGCGCGCCTGATCGTGACGGCCAGCAAAGACTCGACCGTGAAGGTGTGGGAGCTCAGTGCCCCGAAGAACGCCAAGAC
GACGCTGTCGGGCCACGCCGATGAGGTGTACGCGCTGGACTGGAGCCCCAACGGCGACATGGTGGCGTCGGGCAGCAAGGATCGCACGATCAAGATGTAC
GTGCACTGCTTCCCTATTGTGGACGTACTTGGCCAGTCACTAATTCTCCGTTTTTTGTGTGTCATCTCGCAGCTGGAAGCACTAAGCTCGAATTTGAATA
GACCTCATTTTGCCTCTCTCCAAGCGAAAGTTTAACGTTAGCCACTTCAAAGGACTACACCTTGATTCAAGGGCTTCCAACCGCAAAATCGAAAATATAT
TTCACACCTATTTTTTATATTTCCGTAAATACATTTCGTAAATAAATGGGAGAGGCGGGATTTCCCGCCAACTACGCCGCTCACTTCGGCTTTAGCGCGC
GGCCAGCACCGACCAACTCTCTTTGCTGCCCTGCATCTGTTATCTCCAGCATGAAGCGCGGCCGCGACGAGAGCTCCATGGAGGACTGCGACGCCCTGGG
AATGACGCCCCCTCCGTCGTCGCTTTGGGCCTCCATGTCGCCCTGGAAGCCGCCACACGCGTCCGCAAAGCGCTGCAGAGACCGCTCCGTGCCCGTCGGT
GCGTGCTGAAACTCGGTGTTTCAACTTGAAAAATGACTAATTTAACATGCTTGTCCTAAACTAAAGACGCGATGAGCCGGATGATGTCGGCCGCCGTCAC
GAACGCGCGCATCAAGCGACACAGCTCCATCGGCAAGTTGTTCGCGCGCTCGGAGACACCGCTGGCCTGCTGCGCCGTGTGCGAGAGCTCCGGACGCCCA
GCCAAGCACCAGCTGCAGCCCAGCCAGACGCACACGTGCTCGCACTGCGAGAGGAGCATGGGCGACTGCTGCCGGCGCGAATGCGACGCGTGCTGCAACG
TCTTCTGCTCGCTGTGCTCGACGCTCAATTGCGACGCGCAACTGGACCGCGTCTTCTGTTTGTCGTGCAGTCTGGAGCAGTCCAGGGTGTAGAGCCTGGG
AGACTACGAAGCTGAGTTTGCAGCTTGCTGTTGTGCAAGAAGGTTTTTCTAATTAGTAATTCTAAAGTGCATGTTTCTAGTTAATTTTTGTATTTAGCAG
CAGAAGGTGAGGTGGTTGTGAATCTAACTGAACATGCCAATGCCAGGTTGGTCGTAGAGGAAGCTGTGCACGATTTCGTAGGAAACCGCGGGCTGATCGT
GAGGAACCATCTACACATATACGAGAGCAGGTTAGTTGGTGGGAGATGCAGGACATGGGGCTGGGTGAACGTACGTGGCCTGCGTTGTAGACTTTCATGA
AGCTAAGTCCGTGCGAGGTGCGGATGCGGCCGATGCGTCGTCCGTCCAAGTTTTGCTCGGTGGAGGTGGTGGAGGAGAACTCTGCTTGGTGTTTCCAGAC
GAGGTCGCGCGTCCACGAATCCTGCGTCATCCAGTTGACGACGGTGTCGGCATCCCCACCGTAGACAAGCACACGAACGCCCTGTTCAAGCGCCCGAGCG
ACGTTCGACTCGCTCTCCTCAAGTCTGTCCATCGGTGCCAATTGCTGAACCGCTCCGAGCGAACACAACTTCCACTCGTGTGGGATTTCGTCGAAGTAAG
CACGTACACGTGGGCTGTTGACGAGGTTTTGGAGACGTTCGAATCGGTAGCACAGCTGAAGAGGGTCGTCCAGGTGGCAATCACGACGCATGTCGTACAC
GTTTCGTCCACGCTCCCAAATTGAAGAGGAAACAACTACACCAAAGTCAGAAAGTATCTGCAGTGCCTCCCCGCAATCAGGGCCAACGCGATCATCAACG
GAATGGCGCAAGTTATTTCCTTGATTTTCTTGTGATTGGCTCCTGCAATTCGCAATAGACACCTTGAAGCGATCGACAGCGTCCTGAAGTGTTTCCTCGT
TTGACCCAAGAAAATTGTAGCCGTAGTCGTTAGATTTCAAGAAAGTAATCGCTGACTCGACCCAGGCACTTGTCGACACAACACCGTTGCCGATTCCAAT
TCCTTTCAGCGTAGGAAGTGAACCGTCATTCTCGAGCACTCTCACCGCCAAGTCCGGAACGTAGTGTCCTGCATAGCTCTCTCCGAAAATGTAGAAGTCG
TTGGCTTTGAGCTCTTGGTGCTGTTGATAAAATTGGTGAAGAAACTCGAGCATGTCTTCTGTAGCCCCACCAAAAGACCAAGGCTGCTTGATTCCATTCG
TCCCACCGCTGTACCCTGTGCCCTTGGGCTGGTCGAGGTAGATAACGTGCGCGAGTCCAGTCCACGAGTACGGATTGAACGAAATCGTGTCTGCCTCGTC
GTCGAATGAACAAGGGCCATTTTCAAACAGTAACGCGACCAAGCCAGAGCATCCAGGCCCGCCCGAGAGCCATAGAATCACAGGAATGTCGAATCCATTG
GAGGACGATTCGTAGAACACGTAATAGAGACCATTGAGGGTTCCGGTCTCCTTGGCGATGTTTTCCCCACACAACGACACGGATGACGGGTACTCGTTAG
CAAGGTCGTTCGCTTGGGCGAACAAGTGCTCACCATCTGAGAACACACAACACCGCGCTATCAATGCTAGCACGAGCAACCACCAAGCGTGGAGACGCAT
CGCTGATAGAGAAATGTAGACGCGAGGATCGAACCTGACGAGTCACATGCGACCTTTGCTGAAGATTGCGACTAGATGAACGGTTGGTGTTCTGTAGTTC
CACTTACCACTACGACACCAACGAAACTAACATCATCAGCGTCCTTTTTCCAAACGGACTCACACATTGGCACAGCAACGGTTAGAAGCCTTCTCCAAGG
TAACAGCCGTAGCTCGTAGCAACTTCTATGCTTTCATTCAATCTATCGGTCTTCATTTTTCAGCTTCAAGCACAAGTACTCCGCCAGACTCCGTTCGTCT
ACAGACCACGTGACGCTATGCTGTTCAAATCAAAAGTAGATCGACTCCATGATGGAGCTGAGAGGGTCGTAAGCGGGGATGAAAACCTCTTCAGCAGGTA
GAACATCTTCGAGGTCTTCTAGCTGCACTTTCTCAGGGAGCAGGATCCGGGCCTTCAGGAAGGAGCTCCGTGGTTCTTCCGCGGTAAGCGTCGTGTAAGT
TGAGAACGGGAGTTGCTTGGGTGGTGCCTGGTAGCAAATACACACATATTACTTTCAGAAGTGCCAGCAAACAATACCCGAACGAAATGCACCACCTCGA
GTCCGGGCAGCTCTGAACCAGCATTCATGGCGCCGTGTGTCGATTTCGTAGTTCGTGGCATGTTTCCAGGAGGTGAAGCTGCACCGAGATGTGGCGCCTC
ACCAACAGCGCACTCTTCGTTTGCAGTCACCGGTGTTTTGTCCTGCGACCAGGTCCCGTTGAAGCAGAATCGACCCAACGAGCCCATCGCACTCTTCTGC
TGCTTGTTAGTAGGTGGTGTTCGCTTCGGTTTATTTCGTTGCTGGTCGACTTCCTCTCCTTCATACGGACGCTTGCCTCTTGGATGACTCTTGTTCTTGC
GACCAGCAGCCTTCCCTCTTTTGCTGCGGGCAGTGCCCACCTTGGATTCACCAGCGACTGCTCTTTGCTTCTTGCTTGCTGTTGCTGTGTCCTTCACCCG
CCTCGACGGCACTATAGCCTCATTTTGAGCCTTAAATACGGGCGGATGACGCGGAGGCTTCGCAGTAACAGCCTCTGTAGGCTGGTGGTGCTTGACTTGC
TGAAGGAAGCTGTCCATGCGCTGTTGCTTGGCGTTCGTCTGGTGACTTGTAAGCGTCTTAATGTACCGAAGGATGCTACTATCTCCCGAGCTCTCATTAG
GAGCCACTTCCTGCCCACTCGGAGCTTCAAAGGTGCGCTGCACCATCGCGTTCTGCTGGCAACTCGATGCGGAAGAAATGCAGAGTGATGGTATCAACTT
CAACTTGCAGTTTCTTTTAGTAAAATGTAAGAGGTCGCGCTAACTTATCTGTTGAACCACCGCTTCTTCTTAGACTTGTGTCGGCTGTAGACCACTGCGG
CTCGGCGACCCCGTCGGGAAATTGTGAGTGACGTAAGCGCCGAGCTGGGCGCCGCGGAGCTTGGAGGCTTCCAGGAATCCAGCAGGGAATAGCGCCGCTC
GGAGTTCATGGCACTCGTTCCACTCTGCCGACTCAAGTAGGTTGTCGCTTCCGACGGGACCTCCCCTCCGGCTGGAGGCTGCCGGCGAGTTGATGGCGCT
TGCGAGTAGGTGGCGTTGATACTGCTCATGGGGATGTTATTACCTGCAGCAGCAGCAGCCAGTCTGTTGACTGGCTTCGCGTCGACGTCGTCGGGATTCA
AAGGCACACTTCCGCGACGGGGACGTGGCCGGGTAGCGAAGATGTCTTCGTCGTCTTCCTTCTCGTCATACTGGGCCGCTTTCTTCGAGTGGTACTGAGA
GTCAATCGGTTCGTATTGAGCTCCTAGCGTCGAGTAGCGTACCGATGTGGGCGAAGGTAATGGCGAATCGAGTGCCGCTTCTCCCCTGTATCGGAAGCTT
CGCGGCGCAACAGCATCCCCCACCTCGATGGCTCCAGCTGTGAAGTTGATGCTCTTTGGAGGGACCTGGATAAACGTGCCATCGATGTCGATTTCGCGGT
CGTCAGGGATGCCTTTGATGTCGACACGGATAGAAGGCTCACGCTCGCCGTCAACATCAAAACTTCGAGTGCTGTCAACACCTGGCGCTGCTCTTGCTCC
ATCCACGTCGAAACTTTGCGTGCTTAAGATGTCCGGGTCCGCAGAAACTACGTTAGCTGCCACTGGTGACTTCGTTTCCGATTGCCCAGTTTTAATTGAG
CCACGGATGATTGAAGGTCTGCTTTCCAGTGTGAAGTTGTGCCAACGACCCATGAAGCTGCGTGAAATCTGCTTCAAGTGCGTTTCTTTTGGCTCTTCAG
CATGAATGATGCGCAGCACACGATTCACATTGGAAAGGAGTGAGGCCTCGATCTGCTCCTTGTTTTCCAACAATCCTTCCAGGAACGCTAGCGTTTGAGG
GTAGTATTTGAGGTCTTTCAGCCAGAACTCTGGGTCATCCTTCGCCTCGCTTTCTGTAAGTGCAGTGTTGCGTGCCTCCAGTACACGACGAAGAACCTTC
AGCAGGGACGGAATATCTGGGTGCTGCATGGTGATTCGACAAATGAGCAGCTCCATAAAGTCTTTTGAAACGATCTCTGGAAACTGCACCAACCGCCGGG
CAACGCGTAGAATGCAGCGGTACGGAAAGCTTGTGATCAAGTTCTGGTTACAATAACGCACAAGCTTCACGATCTGCTCTGGCATGCGATTGTTGGCAAT
ACTCTCATCAATATCGAGGGATGCCCGCAAGATATGTGTCATAGCCATGGTATACTTGTCGATCTGATCCGCCGTTTTCTTGAGATTGTCGGGAGGATTA
TGAAGATCAAAGCGCATTAAAAGGTCGAGCTCAGTTCTCCACGTTTGAAAAAGCAACTCCAAATTATAGGCTGGGTTCGTTAGCTTTTCTGGATCCGGCC
GGGACAAAAAGCGATCGATGTAGAGACCAGCCACAAAATTCTTTGGGAACGAGATGCAGTCAGTTTCGTCGTCCAGCAGAACGGAGTCTCGTTTTGCTAC
AGACCGCTCGAGCCGATTCCGGCAAATAATGGTGTCAAGCTTCTTGCGAACTTCTGTACGTCTGTGAGAGTTCCAGATCAAGTCGCTCTTTTCGTGGTTA
TCATCGAAGAATCGTGACGCTTGGTTTGGGTCCAAGTGAATTTGGTACACAATTGGGTACGGTAGGAATCGGCAAAGTCCACTGTACATCTTCTCTCGCA
GCTCCAAGTCTTTCATCAGCAACGCATATAGAACTTCAAACGCTGGCGCTCGCAGCGCTTCTGCTCGAAGAAAGTGTTCGTGCAGAACGTGCTGTCTCGA
TTGAAGAGCAATGCCCAATATCTCTACCCAGAGCCCGCTTATTTGTACGTACTCAGCAATGACTAGGCACGTATCACACAGCTCCGCCAAGCAGGAGAGC
GCATAGAATGCTTGCTCATATCCAAGATGGTCCGTGATTACCTGAAGGCACCACGTGAACTGGCAAAAAGGTGCCAGCATTCGCTCTAAGTTGCACTCGA
ACCCGCAGATTTTGTTTAAGATCAGCAGTGCTAGTTCTTGGCGGTTTAAATAGTCGACGTTTCCAAACTCAGCTTCCATTCCTGGGGGTACATCGTCAGT
TTGAGCCTTCGCTTTAAATCCATACGTTGACAACGATCGCCGAGATGATATCGATACACCCTTCGATTTGTCATCGCCATCGAATGGCAACAGATATCTG
CCTAGCGTTGCCACCGATATTGAAGCGTTAACAGGATCTACATCATCAATATGCTGCTCAAGACACTCTACGATTGCGGGCCGAAAAGCTGGCAAATCGC
AAAGAAAGCTTAAGCAATCCAAAGCAGGAAGCGTGTCCGAATAAATACCAAGTTTAGGGTCTCTGTTCTCGTTCAAAAACAAGAACAACGCCGACACAAA
ATCAACGGCTGTGGTTGGGTACAGCATGTCCTCAGTAATTGCTTGAGGGTCCTCCTCCGCCTTCTCCAGTAATATCAGCAGGTAGATTCCTCCAATAAAT
GGCTCTGTACTTAGGCAATCATACATGTGGTTTGCAGCGGTTTCCAGAAACGACACTCCATCACCATTGGGGTCGGTACAAAATTCCTCCGTAAGTTGTG
AAAGTTCAGCTCTTGTGCTTTCGTTCCAAATACACGTTGGCTCGCGTATATCTGACAACAGAATGGTACAAAAGTCATGCCCTTTGGGCTTTTCAAGACA
ATCTAAGAAATCCATTGGAAGCAGATTTGCCAAGGCATCAAGCCCCGCCGATCGTCTATTTCCATCCGGACCCAGAGCAAGAGATCGGAGTGCGCCAAAG
GCACTCTCTAGCATTTCACGCTCTTGTTTCTCCAAAGCGGTGGTAGATCCCTGTGACGTGTCAATTCCTGATGAACTTTCAGCCGATGCCAAAATCAAAT
ACAGACCCTTCCAAAATACCCGTGTGGATGTCATGATTTGCTCCTGAAGCTCGTGGCTCCTGCACAGTGATGACGCAATTTCAAACGACATCTTCTGGAT
ATGCCACGGCTGGATGTTTTCAAATGAAAGAATGACATCATCTAGCAGAGAATAAACGCGATGGGCGTACTTGGACCTGCATGCTCCATTTTGAGACGTG
TACTCCGTCGCGGTAAAAAACGAGTTGTTGTCATCGTCCCCGAAAGTGCTAAAATCAAATACCTTCGACGGTGGCGCCCCGTTGCTTGTATTAGTGCCTC
CTCCTTCCAAAAGCGAGTCCACGCCTTCTTCGGAAGCAAGAAGCAGTTGAAGAATTGAGAACATGCTTTCTTTTGCAGCCACGTCGCGCCCATATGCACA
GCTTTCGACTAAATTGAGAATAGTGTCCCAGCTGCCATCGACTTTTACCAATAGCGGACCATTTTGTGGCGCAACAGAGAGCAATCGCCGCAGCACGCTC
ATCGCCAAACTACGAAATTTGGACTCCCCCGACGATCGAGTCGATAGAACGCGAACGAGTAGGTCCAGCGTCGAAGACTCGTATGAAAAAAACTGGTATC
CAAACTTGTCCAGCAATTGCAATTGTGCCTTCAAAACGCGCTCTATGACTTCGTCCGATGTACGCCCACCATCAGCTACGTCCCTGCGCTCAAGCAAACC
ATTTAGTGAATCGAACGCGTTGCGCACTGTCGTTACCTCGACCTCTTGTTGACACAGTTCACGAAAACGCTGACGCAAATCCGACGACGCGTACGTCACA
CCTTCACTCCACCCAAACACCTTATATGCATCCGAGTGATCTGCATCCTGATCAATCCCATCCGTTTGATGGCGTACCAAGTACCGCCACTTCTCCTCGA
TACTCTTCATGAGGAATACAGGGTCTTCAACCTCCTCTTCAGTATCAGAATTTGACTGATTAAAAGTTGAAAGATAGAACCCACTGCAGTACACGTCTCC
AGACAACTCCAAGAAGGAAATTGGCGGGATTGGAGTGTAGCTGTACCTAACAGCAACACTTTTTCTGAGATCCTCTTTGAAGTCTCGCAGGTGTTCAGCC
AGCATCTCTTGTAAATGCACTCGCATCGTAGATGACCACATTACGCGTTTGTCTTTCTTACGACCAATAAAAACATCGGCAAAGTGTTCAGGTGGCTCTG
AATCCAGAATATTGATGAGGGACTCTGGAAGCATGTCCGTCAATTGACTCTGTCCTGTGTGCAGCTCCGATGATCGCTGAGTACGATGAACTCTTTTAAG
AAATGCTGCTTCTGGAACGAACGCAGGCACTTTGTCCGCTTCTCTGGCAATAGCGACCGTAGACAATATAAAGTAGAAGGTTCCATACTGGTGTAGATCT
TGCAACTCCCCATCACTCAGTGACATCAGCATTTCACACACGTAACGCCGCACGCTCGAGTCATTTACAAGCAGCAGCTGGATCATAAAGGCCAACGATG
ACGCATTAGCTACGACGGTATTCACTAAGGGTGGTGGCCACAAATTTTTGTTTCCAATCGACACTGTGTGCTGATCTTTGATCATAAAGTTCCTTAGCGT
CTTCAAAGCATACGCAGCACATTTCGGATCCATGGGTTCATCAGTCAGCTCCATCCAGCGCAGTTCTGGGTATTCAAACATCGACTTCCACGTATGTTCG
TCACCATCTGAACCCGTGTGTGTCGAACAGCTACACACGTATAGGGCATCAATTTGGCGGTGCCGAATGAGAGGATCAGCTTCCAGATATTCCTTCAGCT
CGTTCGCCGAGTATGGGCCATTCACCTCACTGTTTCCCTCAGCATCCCCCACTGCCTTAAGCTTTATGCTCCATTTGAGCGCAAACCTGGATTCGTCGTA
CAGGGAAAGCTCTGCAATCGGAACTGAGGAGGTTGCGTCAGCTCCCGACATGACCAGTGAGTCCATCATCGGTATATCACTACGATCGTCCGTTACTTCA
CTCCCTATTGGTGCAGGCCGACGTCTGTGAGACAGCATCGACATGTACAGTAACACTTGAATGTAATTTTTAGTACATAACTCAGCGCAAGCCTCTCCAG
ACAGGCTCAATCCAGATATTAATTCGACGACATCTTGAATTTCACTCGCAAGGTATGAGTTCCGCAGAAGTTCGGTGAGAAATCGAGCTCGATGTTTTGT
GATAGGTCGAGCTTCGGGGAACACATGGGCTAACTCGATCAATATTTTCAACATCGAGTGGCCATGTTGCTCGCTTCCAGTTCCTCCAGTAAAATGCGGA
AATCCGTTGCTTCCACTTGCAGACCAATCGTTAGTTCCAGATAGCGGAATATTGTTCAGATGAAGATGTTCCAGCCAACACTGATAAACCTCGCTGAAAA
ACTTTGCCGGGTCCTTCGCAATATCCATACTGGCGAAGAAAAGGCTACTCGAGTTTTTCAACTTTCCACGATGTGTTCCTGATTCCATCGATCGAACAAC
TTTTGCGACTTCTGCCAACTGCAGAGATCCATCGTTTATTCTTTCTGTGATAACACGGAGGTAAAATCGATCAACCTGAAGCTCTTTGGAAATGCTTTCG
TACCTCACAGAAAATTGTGCGTGATTCCACTTGGGCTCTCTACTTCCTTTACGAGAAGCAACCAAGGATAGTGCAGCGGCTTGGTTAGCTTTGAACTGAT
CAAATTCGTCGATCTCCGATTTGAGAGCAGCCTTCAGCTCACCTCGTGTTAACTCGTTCCAAATTAAGTCGGGGAGAAAAAAATCTTTGCCGACCATACT
TGACAGGAGCGCCATGTCGGTGGATGATTCGCCAGGATAGTTCATACGTGAAGGATCCTCCTTGACTCTCGCTTCTTTTACTGACCCACTTGCAAAGAGT
GTCCCGATTTGAAGTTGCATCCGACGGATAAACCACTCCGAGCCGTCAACTTGATCCTGAAGCTGGTGTTTGCTCTTCCGCCTGGACTCTGTTTGCCGAG
CTCGCTGTTTCTTTAGCAATTTCCGTACCATTGGGCTTGAGATCATACGAATGAAACCATGGGGAAGGATCTTCACCAGCATCTCATGAGAGGGTTTGTG
GTGGGTAACCCAGATGCTTGCGATGTACTGATACGTCTCCTTCGCATTATCCGAGGGGTGAAAAAAAGCCTTGCGCAGGTGTTTAATTGTTAGGCCGGAA
TCTAGCGCAACGTCACAAATGCGTCGCCTCATCTTATGATCACCGTGGTCGACGATCACCTTTAACACGCAAATCACTGCCGCTGCTAATCCTGCATTTA
CACTTTGAGATGCCAACTCCAGCAGCAAGGTATACTTTCCTGCAAGAGCTTTTACCAGAGCATCAAAATGATTATTATCAGTGCTGTGCCGCGAAACGAC
GAGCACATCCAGCATCAGTTGCAGCATAACCAACGTGGAACTTGGATTTCGTTGTTCCAGGAGACCAGTCAGTAGCGAAATAAGCTTATTGTACTCAAAT
ACTTGAAATCGAATGTCCTTCTCAGCCGCCCGATGCGAATTTGATCGGGATTTATCAGCAACCAGCGAGTGAAGTGCATTCACGGCCCACACAGTTGCAA
TCGGGTCACCAGAGACCAATACTTGAGCCAGCGTTGGAACTATTGTCATAGCACCGCCGTTCGACTGCTCCATTGTAAACCGATAGCATCCATCATTAAT
GCGGCAAAACGTTTCCAAGATAATACAAACTTCGTTCGCGCGAATTGGTGGCTTGCAGGAGTGTTCAAGCTGCACCGAAGCCATAATAAACAAAATGTTA
GAGGTCTAAACAACAAAATACTACGCATAAGTGCAATTCAGGCCCACTTACCAAATTATTTACCCCACGAAGCAGGGACCCGAATGAAAGCTTTTCCAAA
CGACCGCGCATGGATTTCCCTGCAAAATCATTCGTCTCAACATTCATATTCAAGCTCTCGAGCGCAAACGTGATCCTGTTAGTCGCAGACGTGATACTCA
CGCCTTCCCCACCCATTGTTTCAATTTCTTTTTCCAGAAGTACGTGAGCAGGAATGTATAGTCCGTCATGGTTTAGATAGAGAAAGTTCTCCTGCTCGTC
CTTTAACAGTGCTCTGGGAGACATTCTCGGGTTTAGGTTGGGAAACTCGCGACTAAGCGACACATTAAAATTATCGACATAGCGATATCCGTCATACAGC
GCTGCCAGAAATTTTTCAACATCGTATGGAACGTAAACCACGCGACTGCAATCCGAAAATTCCAACGCTACCATAGCCTGAGCGTCAGTGCTGTCTAATC
CAGGGATTACAACCCGCCGCAAATTCTTGAGGTCGTACGTCTTTTTCGAGCAGTCAGTAAGCTCCTGAATTGTTCCATGTACGAAGCACAGCTTCTTTTT
CCGCAGATGAGTAGATCCATGTCGACCTGTTCGTCTTTGAACGTCAAAAACGTCACTCGATTCAAGAGCACATTGGTCAAGAGCCTTTTCAATGGATTGT
TTCGGCAGCTTGTCCCGAGTTTTGAATCGTAGATGGATGCCAATGACACCAGCTAAGGTCTTCATTTTCGTCACAATATCATTGCTTTGGTCGGAATAAA
TAAATTTTAGCTTTTTCTTTGCGGTCAGTATGAACGCGTCTGGGATGCTCGCGGCCTGCGTTATTTCTTCGATGGTGCGGTATTCAAATTCATGAGTGTG
TCGATTTAGAACCCGAACAGCGATTAGAGCGCGTGGTGTCAGATAAAAATTGGTCTTTTCTCGCTGTCCATCTGCTGCACCAATAAAGCCGCTGAACTGG
CAGCAGTCTACGCTGTACACGCGTTTGAATTCCTCAAAGTTACCCACCAAATGACTCATCAGCTCCTGCAGAAAATTATTTCGACATCGGTAGCGGAGGC
GTAAAAATACCGGGTCATCGTATTGATCAATGCCCATCTTCAGCGACCCGCACGCAGATTCGAGAAACTGCCGATACTGCCGCAGCAGTACTTCAGGATT
CTGAACCACTACCATGCTAGGTGCAGTTCCATCATTACCACTTGATAGCGACTCTGACGACGAAAATGTGTTTCGGCTGGACGAATAGTTGTTTCGTCTA
GACGAAAAAATGTTTGGATGACGAGAAAATGGTGCGACGGCTCCGCGTTGGCTGTTAGGCCCGAAATTCAACGTTTCTCCGAAACTGAGCGTTTGCCGAG
GAACTTGCCCGTCATTGGACCGCAATGGGGAACCCATATTACCAAAGTGCAAAAATGCTGGGGTTTTCGTCATCCGGCTCAAAATGCCGACGCACGCTTC
CACTGTCGCCAAGCCAGGAAAGCTGAAAAGAATTCGAAGTATCATTCGGTATTTCGTTGCTAGGTGTTGATACAGCGTTTCAGACAGTTTTCGCTGCTTT
TCGATGTTTGCCTTGACCAATAAAAGAATGAACTGGCACAGCTTCATTGTCGGTAGGTCGGATAAGAAAGACCTCGTCTACATAGCAAAGCAAACTCGTT
AGAACACACATCGCTAAGGCCCAAACATTTTTCGACGTACATGAGTGTCTTCATCTAACAATGATAGAAGTGTCATGACGAAAAGACTATTTGATAGCAG
GAGCTGCCGACACGGCAGCTTATGCGCCTTGGACTCCATCAACCGGCTCAAGACCATGAACATCCAGTAGATAGCCACGGAGTTCTTGCTCACCAATATC
TTCGATATCATGATCATGTACTCTTCTCGATGCTAGATTGAAAGCAAAAACAAATGAGTAAATTAAATGATACCTCGCACGACATGTGAATGCGGCGGTC
ACATGTACCTCTGTCAGAATTTGCATGAACTCGTTGATCGCAGGCGGTGCAAGCATCAACCGATAGAGTGACTGGAGATACGTGATCACAAAATCCTGAT
TTGCTCCGTGACGTTTTACAATGTCATTGAGCTCACGTGCAAGCACATACAGCACCCTCTCGAACGGTTTGTTCGGCTGGGCAATGACACCAGAAGTCGG
CGTATTTGCGTTTAGCTCCGCCGCCAAAGAGTGCATCTCTTCGTCGAGACCTCGAGGAAGCTGGCGCTGAAAGCGCTCTGTCTTACGATGGCCATGTACA
GACATTAACTGCAGAATGGTTGCCTGGGCAACACGGAGCTCGCGATCCAATACGTTCACATTCGGCACAATGTTCGCGATCTTGTTGCCTTCCTGCAATA
TTATCTTTCGCGGTATCATACGCACCCAGTCCGGAACCTCCATGACCTCCACGCCCACTTGGTAATTCCCTAGTGCATGACACGACGCCAAAAGTTCGCA
TACGATCTTCTCGCGCTGGGCAGAATAGTATTTGCGCTTGATGCCATCCACGTACACGACTTCAAACGCCTGCAGCGTGTCCTGGTACATGATGAGGCTG
TAAATGCGCGACAACGGGCGACTGGAGATCACCGTCGTGGCGTCTACGTATTCCGTAATATACTTTTCCGAGACGGACAGCGTCCGTGGGGCAGCGCTGG
ACTCGTTCGACTGCGACACTTTGAGCACTTGGTACTCGAACGAGACACTGGTGGTCGACGAATCTTTCCCGTCATCTTTGAGAGCAGCCTCGATGGTTTT
CTTGCGGTACTCGTTGATCTGCATACCGTAGGCCTTCATGACTCTGTCGATAGCCTGCGCCAGCTCTGTGCGTCTCGGCACAATAAACAAACTCGAGTTG
TCCGAGTGGTTGAGCGCGATGGCCTCATGGTCGTCGCAAATGAGGTCTATCGAGACCAAACTCGTGTACGGGATGTGGCTCATGAGGTCTCCCTCCGTGT
CCTTCTGGTAGATGCCGTCCGGTCGCACCTCCACCACGCACGTGGACTGCACACCGCCCCTGTGGCACTTGAGGCTCTGGAACGCGTGCGTCTGCAACTC
CAATGGCGGCGGTTGTCTAGCGTCGGGCGCCTTGGCGTAGTGTTGGCTGCGCAGCCGCATGAGGCAGACCAGCACCTCCATGCGGAAGTGGCAGCGGAAG
ACCGTCTTCTTGATGCGGTGGCGCGGCGTGTGGATGACCAGGTCCGTCTCGCCCTCCAGCACGTTGGCACCGTCCACGTCCTCGTACGGCCACGTATTGG
TCACGTGCTGGTTCTCTCGGTCCAGCGTCCAGAACGAGTACTCCCCAAGGCACAGCACACGCTCCTTGAGCACGAAGCTCCCGACCTTGTGCACCATGAA
GCGCGCCACAACGCGCTTCATCTCCATTGTCGAAGGTTCTCCCCCGCGCTCTCTCGCTGTGAAATTGCCTTCTGCCGCCTCTGGATTCTTCGTACGCAGC
TCGATCTTGCTGGCCAAAACACTTAGTGACGGCAGAGAGCGTCGAAAGGTCGCGGATTCTGAAGTACAAGGGTTGTTCGTTGAAGTACGATGGTTGGAGC
AACTTTGTGTGGCGCAACTTAGCAACTACAACTTGCCTTTTTCGTGCTTGACTTGCTGTTGCGTACAGCTCTGCGGTCGATTTCCGTGCTGAAGGAGGTA
CCGACGAAAGAGGTGCGCATTTCGATAGCAAAGGAACCCTAGACTGTGGCACGTAGAGTAACACTGATAGAGCCGGCTTCGGCACTGTAAATCAACTTCC
CCCAGAGATTGCTTTAGCGCTGCGCGCAGCAACAATAGTTTTCCACGTGACAATGGACAAGCAAATTTGGACTGGCCGCAACAATGAAGCAACTTTGTGT
ACTAGCAGGAGCGAGATCGTTTAGAGGCGTCGTGAACTTTGAAGGAACTCGCGTTGTGCTCTGTACTATCCGCTTGGGAATGGACGCCTGAGGGATCAGC
ACAATCATGCTCTTAGACTTCGTCATACTTTCCACTATTTCTCCGTGTGTGGCGCCGCTTATATGATGTTTGATCGTGCTTGTAGATTTCCACCGCTCTT
CAAAAATAAGCGAGTGATCTCGTCGTCGTCTGGACTCGAACTGTATCCTTAAGTACGATACCCGTTTAAGTCCGTGTCTTATTGCCTTGAGATTGTATGG
TTCTTACTAAAATCAAGTCTTTCGCGGGTTTTGGTGGTGAGCGGCTCGATGTGCGGCTCTGGGGCTCTGAGCACAGAAACGCGTTTGGCGCTGCACCCCC
ACCAAGTCCCTACCAAGATGCTCGCGTCGTCGTCGTCCAAGCTCGCGGCCCGCGCGTCGCGCTCGCTGTTCACCAAGGCCAGCGCCATGCCCAGCGTGGC
CCTGAGCGAGGAATTCCCGGCCGTGCCCAAGACGCAGCCGCAGGCCACGGCCGCGCCCAAGCTGACGGCGTCCAAAGCCTCGTCGGGCTTGGCATTGGGC
TCGGACGACCGCGCGGCCCCCGTGGCCACCATCGGCGTGCAGCTCAGCACCGGGTCACGCGACGAGAGCGAGGACACGGCCGGTGTGTCGCAGCTCTTCG
CCAAGATGGCCTTCCGTGCCACGGCGACCCGCTCGGACCTGCGTCTGTACCGCGATGTGGAGGCCATCGGCGGCGTCGTGCACGCTCAGGCCGGCCGTGA
CTTTGTGCGCTACAGCGTGAGCGTGCTGCCCGACCAGCTGGAGGCGGCCGCCGAGATCCTGGCCGAGACGACGTTGGCCCCCAAGTTCGCGCTCTACGAC
GTGGACGAGCAGAAGAAGATCGTGCAGGCCGAAGTCGACCGGATCGGTGATGATGCCTCGGCGTCGCTGCTCGAGGGCCTGCACGCCGCCGCGTTCTACG
AGGACCTGACGCTGGGCCGCCCCGTGGCCGCCGCGGACAACCTCCAGGCGCTCAGCCCCGAGGCGCTCTGGGCGTTCCACGACAAGTACGTGAACACGGC
CAACGCCGCCCTCGTGGGAGCCGGCGTGAACCACAGCACGCTCACGGACCTGGCCAACGAGTACTTCGGCTCGTTCGCCAAGGGCGTCGAGGCCGCCAGC
GCCACGGCCAAGTACGTGGGCGGTGAGACCCGCGTCAAGAAGGCAGCCAAATTCACGCACGTTGCTCTGGCGCTGCCGACCGTCGGCCGTGACTCTGCTG
ACTTTGGCGCCTCGCAGGTGCTGCGCGCTCTGCTGAGCTTGCGACTCAACAACAAGAAGGCGTCCGCCTTCCTGTCCAGCTACAGCGACGCCGCGCTCGT
GGGTCTGTCGGGTTACGCCGTCCACTCGGAGGCCGGCGCCCTGGTGGACTCGTTCGCCGCTGAGCTCAAGAAGGCTGCGTCGGCTCCGGCTACTAAGGAG
GAGCTGGCCGCTGCCAAGACCACGGCTGCGCTCGAGGCTCTGGAGCAGTACAGCACCCAGACGGGTACCCTTGGCCGTGTGGGCCTCATCGCCACCACTG
GCTTCGTGTCCCAGTCGCCGTCGGCTCTCGTGGAGGGCGTGACCGCCGCCAAGCTGCAGGAGCTGGCCCAGAAGGCTCTGAAGGCCACGCCGTCTGTGGC
GGCCATTGGCAAGCTGTCGGCCGTTCCCCACGTGGACGCGGTGGCCAACAAGCTGCAGTAAACGACCAAGACGATCGATCAAGAGTGAGGTACATACATC
AGTTTAGCACTCGGAGCTTTTGGTGATGCACGTTGAAGTGACCTTGGCGTGAGTGCGGATGAACAGGACAAGACAGGAGCGTTGGATGTGGAAGCAGCGC
AGAGACGCGGTAGAAACCTCGAATTAGGAAGGGGGCATACAACGCTGGCGAGAGGAGAGGGCTGCTCAGACACACTCGTAACGCGAGGTGACCGATCGTG
CGAATATCGCACTAAATGCAAGAAAAAAGAACCAACTTTTTAACGACAAATGCTCGGTCAGCGGAAGCCGTTGCTGTGTTTCTGACAGTTCGATTCAATC
GCGCAAGAGCTGGCAAACGGCTGTAGCAGGA