Description :
From Genome Similarity Track
Location :
Scaffold_320:1805- 2983
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_320-snap-gene-0.17HECT ubiquitin ligase

Sequence
1178 bases(100 bases per row)
GTTGTGAACCCTTGCACCTCGGCGTCGAGCAAGGCGTACAATACGTGCTCCAAGTCGACTCGTTCCGCGTACAACGGCAGATCCAAGCGATTGAAGCACG
CGTGACTGCGAATGTAGCCGCCGCTCACCCTCCAGCTCACTCCCCTCAACGTGAAAGGACACGAGCGACCGTCATGGCTAGTCAGCGCGGCGAATCCGCC
AACTGGGACACGAGAAGATCCCGTGGCGAACCGTAGCAATCGACGGCGGTATTCGAGCGGCATCTCCTGCACCAGTTCCCAGAACCAGCGCATCGCCAAA
TGACCCTGCAGGTCCGCGTTGTACCTCGTGTTCCGGCGCCAATCATCAACGTCGATGGCGTCGGACCCGCTCACCAAGTAGTCGAGTTCTTCTGGGTCGA
ACAGCATGAGCAAACTCCGCGGGATGACCTCGCAGATCCCCGATACGAATCGAGTCAGCGCGTGCTCCACCCGACCGAAGACAAGGTAGTGGAACTTGAG
CATCACGAATTCGAGCTTGTTGGCGTCCGTCACGTCCACACTTGCGCCGCCAGGAACGAGTTCGTACTCCACCATTCTCGAGTCAGCTCCACCTCTAGAC
TCGCTGACAGCGAACGTTAATGCCAACCCGTCAACGTCGTCGTGCTCGAGCAGCCAGTTCAGGCTTCGGAAGCTTTCTGGGTCAATATATTCGAGGTCGT
CAAATGTGATGGGGACACCGAGGATGATCTTGAGCAACGGTAGCGACAAATGAAAGCCAAGCGGGACTCCTTCCAGCAACGCGCGACCGACGAACCGACC
TGCCGCCTGCGAATATGCGAGTTGCTGGTCCAAGCTGCTGAAGCTGGCGTCGAGGTTGAAGGTCTGGTCTGGATCGTTGGCAGCGGCAAATACTCGGGTC
TCGGATTCGCCAACAAGTCCTTCGGCCACCAGACAAAACCACTCTCGCAGCAACCCTCCGGCGTCTACCCCGCTCTCGCCCTCGAAATGAATGCGCATGG
ACGAACGCACTTGCGACGCAGGTACTTGACTCAACAGTGTCAGCGACGCGTTGTATGCCTCTGAACGAGCGACATTCAGCTGAATGGGAGGATGAGCACT
ATCGGCTTCGCCGCGCAAGGACGTTGTCACCGTGGCGAAATGAGCCAATTTGGTCGGAAAGTCTTGAGCTGCGAGTGC