Description :
From Genome Similarity Track
Location :
scaffold_30:180391- 200923
Transcript NameFunction/comments
g2289.t1 trafficking protein particle complex subunit 2-like protein
g2290.t1 hypothetical protein PHYSODRAFT_566404
g2291.t1 notchless family protein
g2292.t1 hypothetical protein PHYSODRAFT_307611
g2293.t1 mitochondrial-processing peptidase subunit alpha, putative

Sequence
20532 bases(100 bases per row)
AATTCTGCTTGTGTGACCTGTAGCTCCATCGAATGAAGCCTTTTCGCCTCCCGAGCTGCTCGAATGTGCAGATTCTCTTCCAATTCGCACTCGACTTCTA
GTTGGGCCATACGAACTTGCTTGTAGTACTCAGCTTCGAGCGCTCGCCGACGAGTCTTAGAGACAAAACCCTCTCGCTGCTCAAATTTAACGAGCGGCAC
AATACGAACTTGCCCTGCAGCGCTATGTGAAGAATACATTCTGGCCACGTTGGTGGGTGCACTCGCACTGGGCTGGTTGTCGGAATCTTCGTCTTCTGGC
AAACTTAATGGATCGAGTTTGATTTTCTTGGTCAAGCCTGCAGCACCGTTGGCAGGGAGTAAGGGCACTGAGGAAACTCTTAGCTTCCCAGTAACAATCG
GTGAGGGAACGATCGTTGTCTCTATCTTGGCACGAAGACGCTCAATTTCCGTATGACATTCCTCAATTTCCACCTCCAGCTCCTGGAAGCGAAGAAATTT
GCTACCACGCGCGTGAGTAAGCCCCATGAAGTACCCACTCGGTACCTTGACCTTTCTTACCTGCTGTACTTAAGCCGGTCTAACTCTTGCCTCCGCTCCT
CAGCAAGAGCTTCAGCTGTCACAGCCTATCTAACCAACGAGATGACAGTAGCCCACAGTGCGTCAGAAGCAGCTTATTAACCACCGCAAATGTTTAGATA
CGCCACGCTACCATACCCGTTGCATGCATTCGGATACAAGACGGTCAATTAGCTCCTGCTTGCGGGTTTTAGTGGTCTTTGCTTCCTGTGGTGACCTCAG
GATCGCAAAGGCAGCGTGCAGCTACTCGCACACATATCGTAAGCCAACATTTACAGTAAACAATGGCACCAAGACAAACGCCTTACGTCTTTGTCTTTCT
TTCGCAGTGTTTCCTGCAGCCTCCGAGTTCCCGTCTTCAACTGTAGAATTAATGCATCCTTTCCAAATACAATCACATACATCAGCCCAGCCTGCCTGAA
CGCCACATTCCTCAACACGAGGCGCCACCTTCTCTCCCAGCTGCCTTTTCACCAGCACGAGCTCCTGCTTGGTGTTTTCCCATTCACGCCATCCATCGTC
CAGCTACCAAACAAATAAGTCAAATTCCACCATATTTCCGTGCAAAGTACATTTTTCTCCACCTCGAGGTGCTGGTAGGGCGTCACCTGGGGTTGGCTAG
CGCTTCCCCCACGCCGACTCATTAACCGCCTCTCCATGGTGACGTACTTGGAATGCAACTTACGTCGTTTCGTGCACCAGGAAATAAAAAAGTGTAGCCA
TGTTTAAAAGCATAGAAACCCGAAACGTCGCGATCTGCCTGTGAGATACTCGACCACATATCGATATCCTATCTCCTGTAGCATGGGGGAGGCACCGAGC
TGGCAGCACATGTGGGGAGCCAAGGTCAAGATGCCCTGCGATATGGAGGACGACGTGCTTGAAGACGCCATCAAGCACGTCACCTCGCGGCTGACCAAGT
ACGACACCGAGGAATGGGAGAAGAACGGTTTGGCGGTGAGGCAGCATCGCTTTGTGTCAATGTGTTGGTGCTTATACTGATGTATTGCTACTGCCAGGTG
TGTGAGGAGATCAAGGCGCACCTAGACGAAGCGTGGGACCCGCACTGGGTGGTGTGCATCGGCCGGAATTTCGGCTCGTTCGTCACGCACGTCACGAGAA
ACTTTGTCTTTTTCTACTACAACGAGAAAGCCGTGATGATCTACAAAGCAGGATGACTGTAGAGTACGGCGAGGACCAACACAACATCCAGACACGTATA
GTTTGCTGCATTTGAGCGCTTGGTGTCATTATGCGCGAGTTGGCCACAAAACTGTCTGTGTAGGCAATCTAGTAGCTCCATTCATATGTGACGACGAAGC
TGGGGCTACAACGCTTGACACCAAGACTGCACACTGCCGGTAGTAAGAATTGAATCTATCGATACCTCAATGTGAAGCTCGAATTCAAAAGCTCTTCAAC
TAGTGCATGAAGTCACTTCAACTCATGCGCAGTCTGTGATTGGCTGAACGCCCAACAATTCGACCAATCGAAATGCAACGTCTGCAGCCCAACAGTTTTT
GACACAGAAAGCCATTCAAGCAGTCATGGCAACGCACGTCGCCAAGAAGATGAAGCTGGAGCACGAGGCCATCAGCTCCAGCGCCGACGCGAACGCGGCC
ATGAAATCGGAGGACCCAAGCGCCAGTGGCGATGAGGAGGACGAGAACGGCACGTCGGCCATCGCCCAGTTCCAGAGCGAAGACGTGAGCGCAACAGTTG
ACACATTTTACAAAAGCCCTGAGTCTCTAATTGGGTTGCGTTTTGTGCATTGAATAGGGCACCAATGTGGGTCCGCAACTGGAGATACCCACTAGCTCCA
ACGTGCGTCAGATGGAGGAGCTGGTGAATGAGCTGCTGCAGAACGGCAAGAACCGCGTGCCGTACTCGCTGTTCATTGGCGAGACGGAGGTGACGACATC
GCTTAAGGCGACGGTGGAGGAGCTGGTGAGTGGTTGCTGATGTTTTGCACTTTTTGAAACAGGTTGCTGACTGTTTAGTGTGCTGTTTTGGTGGTAGAAA
TTGTCGACGGAGACGGCGCTGACCATCACGTTCCAGCCGCTGGCGGCGTTCCGTGTGCGTCCGGTGACTCGTTGCAGTGACACACTGCAGGGACACTCGG
AGGCCATTTTGCACGTGAGTTTCAGCCCCGACGGAAAGAGACTCGCGAGCGGAGGAGGCGACGCTACCGTTCGCTTCTGGGACACGAACACTTGCATGCC
CAAGCACACGGGTCGGGGCCACAAGAACCATGTGCTGTGTACGGCTTGGTCGCCCGATGGCGCGCGTTTTGCGTCGGCAGACCGCAACGGTGAGATTCGT
CTGTGGGACCCGTTGACAGGCAAGCAGATCGGCCAGCCCATGAAGGGCCACAAGCAGTGGGTGAACTCGCTGACGTGGGAGCCCATGCACCGCAATGCCA
CATGCGAGCGCTTTGCGAGCTCTTCCAAGGACGGATCGATCAAGGTGTGGAACGCTCGCACTGGGCGATCCATCGCCTCGCTGTCGGGCCACACGGACTC
GGTGGAGTGCATTAAGTGGGGCGGTGAAGGCCTGCTGTACAGTGCGTCGCGTGACCGTACCATCAAGGTGTGGTCGATGGAGGGCGAGCACGTGGGCAAA
CTCGTGCGCACGCTGGTCGGACATGGTCACCGTATCAACACGCTGGCGCTGAATGTGGACTACGTTTGCCGGTCGGGACCGTTTGGCCACAATACCAAGA
GCTTCGCGTCGCGTGAGGAGATGCAGGAGGCGGCGCTGAAGCGGTACCAGGAGGTGCGAAAGGGTCAGCCGGAGCGCTTGGTGTCCGGCTCGGACGACTT
CACGCTGTTCTTGTGGGAGCCCGCGGAGAACAAGAAGCCGCTGGCGCGTCTCACGGGCCACCAACAGCCCGTGAACCACCTGAGCTTCTCGCCGGACGGA
CGGTATTTCGCGAGCGCGAGTTTTGACAAGAAGGTGAAGATCTGGAATGGCCAGACGGGCAAATTCATTGCCACGCTGACCGGCCACGTCGGTGCAGTGT
ACCAGGTGTGCTGGTCCAGCGACGCGCGCCTGATCGTGACGGCCAGCAAAGACTCGACCGTGAAGGTGTGGGAGCTCAGTGCCCCGAAGAACGCCAAGAC
GACGCTGTCGGGCCACGCCGATGAGGTGTACGCGCTGGACTGGAGCCCCAACGGCGACATGGTGGCGTCGGGCAGCAAGGATCGCACGATCAAGATGTAC
GTGCACTGCTTCCCTATTGTGGACGTACTTGGCCAGTCACTAATTCTCCGTTTTTTGTGTGTCATCTCGCAGCTGGAAGCACTAAGCTCGAATTTGAATA
GACCTCATTTTGCCTCTCTCCAAGCGAAAGTTTAACGTTAGCCACTTCAAAGGACTACACCTTGATTCAAGGGCTTCCAACCGCAAAATCGAAAATATAT
TTCACACCTATTTTTTATATTTCCGTAAATACATTTCGTAAATAAATGGGAGAGGCGGGATTTCCCGCCAACTACGCCGCTCACTTCGGCTTTAGCGCGC
GGCCAGCACCGACCAACTCTCTTTGCTGCCGTGCATCTGTTATCTCCAGCATGAAGCGCGGCCGCGACGAGAGCTCCATGGAGGACTGCGACGCCCTGGG
AATGACGCCCCCTCCGTCGTCGCTTTGGGCCTCCATGTCGCCCTGGAAGCCGCCACACGCGTCCGCAAAGCGCTGCAGAGACCGCTCCGTGCCCGTCGGT
GCGTGCTGAAACTCGGTGTTTCAACTTGAAAAATGACTAATTTAACATGCTTGTCCTAAACTAAAGACGCGATGAGCCGGATGATGTCGGCCGCCGTCAC
GAACGCGCGCATCAAGCGACACAGCTCCATCGGCAAGTTGTTCGCGCGCTCGGAGACACCGCTGGCCTGCTGCGCCGTGTGCGAGAGCTCCGGACGCCCA
GCCAAGCACCAGCTGCAGCCCAGCCAGACGCACACGTGCTCGCACTGCGAGAGGAGCATGGGCGACTGCTGCCGGCGCGAATGCGACGCGTGCTGCAACG
TCTTCTGCTCGCTGTGCTCGACGCTCAATTGCGACGCGCAACTGGACCGCGTCTTCTGTTTGTCGTGCAGTCTGGAGCAGTCCAGGGTGTAGAGCCTGGG
AGACTACGAAGCTGAGTTTGCAGCTTGCTGTTGTGCAAGAAGGTTTTTCTAATTAGTAATTCTAAAGTGCATGTTTCTAGTTAATTTTTGTATTTAGCAG
CAGAAGGTGAGGTGGTTGTGAATCTAACTGAACATGCCAATGCCAGGTTGGTCGTAGAGGAAGCTGTGCACGATTTCGTAGGAAACCGCGGGCTGATCGT
GAGGAACCATCTACACATATACGAGAGCAGGTTAGTTGGTGGGAGATGCAGGACATGGGGCTGGGTGAACGTACGTGGCCTGCGTTGTAGACTTTCATGA
AGCTAAGTCCGTGCGAGGTGCGGATGCGGCCGATGCGTCGTCCGTCCAAGTTTTGCTCGGTGGAGGTGGTGGAGGAGAACTCTGCTTGGTGTTTCCAGAC
GAGGTCGCGCGTCCACGAATCCTGCGTCATCCAGTTGACGACGGTGTCGGCATCCCCACCGTAGACAAGCACACGAACGCCCTGTTCAAGCGCCCGAGCG
ACGTTCGACTCGCTCTCCTCAAGTCTGTCCATCGGTGCCAATTGCTGAACCGCTCCGAGCGAACACAACTTCCACTCGTGTGGGATTTCGTCGAAGTAAG
CACGTACACGTGGGCTGTTGACGAGGTTTTGGAGACGTTCGAATCGGTAGCACAGCTGAAGAGGGTCGTCCAGGTGGCAATCACGACGCATGTCGTACAC
GTTTCGTCCACGCTCCCAAATTGAAGAGGAAACAACTACACCAAAGTCAGAAAGTATCTGCAGTGCCTCCCCGCAATCAGGGCCAACGCGATCATCAACG
GAATGGCGCAAGTTATTTCCTTGATTTTCTTGTGATTGGCTCCTGCAATTCGCAATAGACACCTTGAAGCGATCGACAGCGTCCTGAAGTGTTTCCTCGT
TTGACCCAAGAAAATTGTAGCCGTAGTCGTTAGATTTCAAGAAAGTAATCGCTGACTCGACCCAGGCACTTGTCGACACAACACCGTTGCCGATTCCAAT
TCCTTTCAGCGTAGGAAGTGAACCGTCATTCTCGAGCACTCTCACCGCCAAGTCCGGAACGTAGTGTCCTGCATAGCTCTCTCCGAAAATGTAGAAGTCG
TTGGCTTTGAGCTCTTGGTGCTGTTGATAAAATTGGTGAAGAAACTCGAGCATGTCTTCTGTAGCCCCACCAAAAGACCAAGGCTGCTTGATTCCATTCG
TCCCACCGCTGTACCCTGTGCCCTTGGGCTGGTCGAGGTAGATAACGTGCGCGAGTCCAGTCCACGAGTACGGATTGAACGAAATCGTGTCTGCCTCGTC
GTCGAATGAACAAGGGCCATTTTCAAACAGTAACGCGACCAAGCCAGAGCATCCAGGCCCGCCCGAGAGCCATAGAATCACAGGAATGTCGAATCCATTG
GAGGACGATTCGTAGAACACGTAATAGAGACCATTGAGGGTTCCGGTCTCCTTGGCGATGTTTTCCCCACACAACGACACGGATGACGGGTACTCGTTAG
CAAGGTCGTTCGCTTGGGCGAACAAGTGCTCACCATCTGAGAACACACAACACCGCGCTATCAATGCTAGCACGAGCAACCACCAAGCGTGGAGACGCAT
CGCTGATAGAGAAATGTAGACGCGAGGATCGAACCTGACGAGTCACATGCGACCTTTGCTGAAGATTGCGACTAGATGAACGGTTGGTGTTCTGTAGTTC
CACTTACCACTACGACACCAACGAAACTAACATCATCAGCGTCCTTTTTCCAAACGGACTCACACATTGGCACAGCAACGGTTAGAAGCCTTCTCCAAGG
TAACAGCCGTAGCTCGTAGCAACTTCTATGCTTTCATTCAATCTATCGGTCTTCATTTTTCAGCTTCAAGCACAAGTACTCCGCCAGACTCCGTTCGCCT
ACAGACCACGTGACGCTATGCTGTTCAAATCAAAAGTAGATCGACTCCATGATGGAGCTGAGAGGGTCGTAAGCGGGGATGAAAACCTCTTCAGCAGGTA
AAACATCTTCGAGGTCTTCTAGCTGCACTTTCTCAGGGAGCAGGATCCGGGCCTTCAGGAAGGAGTTCCGTGGTTCTTCCGCGGTAAGCGTCGTGTAAGT
TGAGAACGGGAGTTGCTTGGGTGGTGCCTGGTAGCAAATACACACATATTACTTTCAGAAGTGCCAGCAAACAATACCCGAACGAAATGCACCACCTCGA
GTCCGGGCAGCTCTGAACCAGCATTCATGGCGCCGTGTGTCGATTTCGTAGTTCGTGGCATGTTTCCAGGAGGTGAAGCTGCACCGAGATGTGGCGCCTC
ACCAACAGCGCACTCTTCGTTTGCAGTCACCGGTGTTTTGTCCTGCGACCAGGTCCCGTTGAAGCAGAATCGACCCAACGAGCCCATCGCACTCTTCTGC
TGCTTGTTAGTAGGTGGTGTTCGCTTCGGTTTATTTCGTTGCTGGTCGACTTCCTCTCCTTCATACGGACGCTTGCCTCTTGGCTGACTCTTGTTCTTGC
GACCAGCAGCCTTCCCTCTTTTGCTGCGGGCAGTGCCCACCTTGGATTCACCAGCGACTGCTCTTTGCTTCTTGCTTGCTGTTGCTGTGTCCTTCACCCG
CCTCGACGGCACTATAGCCTCATTTTGAGCCTTAAATACGGGCGGATGACGCGGAGGCTTCGCAGTAACAGCCTCTGTAGGCTGGTGGTGCTTGACTTGC
TGAAGGAAGCTGTCCATGCGCTGTTGCTTGGCGTTCGTCTGGTGACTTGTAAGCGTCTTAATGTACCGAAGGATGCTACTATCTCCCGAGCTCTCATTAG
GAGCCACTTCCTGCCCACTCGGAGCTTCAAAGGTGCGCTGCACCATCGCGTTCTGCTGGCAACTCGATGCGGAAGAAATGCAGAGTGATGGTATCAACTT
CAACTTGCAGTTTCTTTTAGTAAAATGTAAGAGGTCGCGCTAACTTATCTGTTGAACCACCGCTTCTTCTTAGACTTGTGTCGGCTGTAGACCACTGCGG
CTCGGCGACCCCGTCGGGAAATTGTGAGTGACGTAAGCGCCGAGCTGGGCGCCGCGGAGCTTGGAGGCTTCCAGGAATCCAGCAGGGAATAGCGCCGCTC
GGAGTTCATGGCACTCGTTCCACTCTGCCGACTCAAGTAGGTTGTCGCTTCCGACGGGACCTCCCCTCCGGCTGGAGGCTGCCGGCGAGTTGATGGCGCT
TGCGAGTAGGTGGCGTTGATACTGCTCATGGGGATGTTATTACCTGCAGCAGCAGCAGCCAGTCTGTTGACTGGCTTCGCGTCGACGTCGTCGGGATTCA
AAGGCACACTTCCGCGACGGGGACGTGGCCGGGTAGCGAAGATGTCTTCGTCGTCTTCCTTCTCGTCATACTGGGCCGCTTTCTTCGAGTGGTACTGAGA
GTCAATCGGTTCGTATTGAGCTCCTAGCGTCGAGTAGCGTACCGATGTGGGCGAAGGTAATGGCGAATCGAGTGCCGCTTCTCCCCTGTATCGGAAGCTT
CGCGGCGCAACAGCATCCCCCACCTCGATGGCTCCAGCTGTGAAGTTGATGCTCTTTGGAGGGACCTGGATAAACGTGCCATCGATGTCGATTTCGCGGT
CGTCAGGGATGCCTTTGATGTCGACACGGATAGAAGGCTCACGCTCGCCGTCAACATCAAAACTTCGAGTGCTGTCAACACCTGGCGCTGCTCTTGCTCC
ATCCACGTCGAAACTTTGCGTGCTTAAGATGTCCGGGTCCGCAGAAACTACGTTAGCTGCCACTGGTGACTTCGTTTCCGATTGCCCAGTTTTAATTGAG
CCACGGATGATTGAAGGTCTGCTTTCCAGTGTGAAGTTGTGCCAACGACCCATGAAGCTGCGTGAAATCTGCTTCAAGTGCGTTTCTTTTGGCTCTTCAG
CATGAATGATGCGCAGCACACGATTCACATTGGAAAGGAGTGAGGCCTCGATCTGCTCCTTGTTTTCCAACAATCCTTCCAGGAACGCTAGCGTTTGAGG
GTAGTATTTGAGGTCTTTCAGCCAGAACTCTGGGTCATCCTTCGCCTCGCTTTCTGTAAGTGCAGTGTTGCGTGCCTCCAGTACACGACGAAGAACCTTC
AGCAGGGACGGAATATCTGGGTGCTGCATGGTGATTCGACAAATGAGCAGCTCCATAAAGTCTTTTGAAACGATCTCTGGAAACTGCACCAACCGCCGGG
CAACGCGTAGAATGCAGCGGTACGGAAAGCTTGTGATCAAGTTCTGGTTACAATAACGCACAAGCTTCACGATCTGCTCTGGCATGCGATTGTTGGCAAT
ACTCTCATCAATATCGAGGGATGCCCGCAAGATATGTGTCATAGCCATGGTATACTTGTCGATCTGATCCGCCGTTTTCTTGAGATTGTCGGGAGGATTA
TGAAGATCAAAGCGCATTAAAAGGTCGAGCTCAGTTCTCCACGTTTGAAAAAGCAACTCCAAATTATAGGCTGGGTTCGTTAGCTTTTCTGGATCCGGCC
GGGACAAAAAGCGATCGATGTAGAGACCAGCCACAAAATTCTTTGGGAACGAGATGCAGTCAGTTTCGTCGTCCAGCAGAACGGAGTCTCGTTTTGCTAC
AGACCGCTCGAGCCGATTCCGGCAAATAATGGTGTCAAGCTTCTTGCGAACTTCTGTACGTCTGTGAGAGTTCCAGATCAAGTCGCTCTTTTCGTGGTTA
TCATCGAAGAATCGTGACGCTTGGTTTGGGTCCAAGTGAATTTGGTACACAATTGGGTACGGTAGGAATCGGCAAAGTCCACTGTACATCTTCTCTCGCA
GCTCCAAGTCTTTCATCAGCAACGCATACAGAACTTCAAACGCTGGCGCTCGCAGCGCTTCTGCTCGAAGAAAGTGTTCGTGCAGAACGTGCTGTCTGGA
TTGAAGAGCAATGCCCAATATCTCTACCCAGAGCCCGCTTATTTGTACGTACTCAGCAATGACTAGGCACGTATCACACAGCTCCGCCAAGCAGGAGAGC
GCATAGAATGCTTGCTCATATCCAAGATGGTCCGTGATTACCTGAAGGCACCACGTGAACTGGCAAAAAGGTGCCAGCATTCGCTCTAAGTTGCACTCGA
ACCCGCAGATTTTGTTTAAGATCAGCAGTGCTAGTTCTTGGCGGTTTAAATAGTCGACGTTTCCAAACTCAGCTTCCATTCCTGGGGGTACATCGTCAGT
TTGAGCCTTCGCTTTAAATCCATACGTTGACAACGATCGCCGAGATGATATCGATACACCCTTCGATTTGTCATCGCCATCGAATGGCAACAGATATCTG
CCTAGCGTTGCCACCGATATTGAAGCGTTAACAGGATCTACATCATCAATATGCTGCTCAAGACACTCTACGATTGCGGGCCGAAAAGCTGGCAAATCGC
AAAGAAAGCTTAAGCAATCCAAAGCAGGAAGCGTGTCCGAATAAATACCAAGTTTAGGGTCTCTGTTCTCGTTCAAAAACAAGAACAACGCCGACACAAA
ATCAACGGCTGTGGTTGGGTACAGCATGTCCTCAGTAATTGCTTGAGGGTCCTCCTCCGCCTTCTCCAGTAATATCAGCAGGTAGATTCCTCCAATAAAT
GGCTCTGTACTTAGGCAATCATACATGTGGTTTGCAGCGGTTTCCAGAAACGACACTCCATCACCATTGGGGTCGGTACAAAATTCCTCCGTAAGTTGTG
AAAGTTCAGCTCTTGTGCTTTCGTTCCAAATACACGTTGGCTCGCGTATATCTGACAACAGAATGGTACAAAAGTCATGCCCTTTGGGCTTTTCAAGACA
ATCTAAGAAATCCATTGGAAGCAGATTTGCCAAGGCATCAAGCCCCGCCGATCGTCTATTTCCATCCGGACCCAGAGCAAGAGATCGGAGTGCGCCAAAG
GCACTCTCTAGCATTTCACGCTCTTGTTTCTCCAAAGCGGTGGTAGATCCCTGTGACGTGTCAATTCCTGATGAACTTTCAGCCGATGCCAAAATCAAAT
ACAGACCCTTCCAAAATACCCGTGTGGATGTCATGATTTGCTCCTGAAGCTCGTGGCTCCTGCACAGTGATGACGCAATTTCAAACGACATCTTCTGGAT
ATGCCACGGCTGGATGTTTTCAAATGAAAGAATGACATCATCTAGCAGAGAATAAACGCGATGGGCGTACTTGGACCTGCATGCTCCATTTTGAGACGTG
TACTCCGTCGCGGTAAAAAACGAGTTGTTGTCATCGTCCCCGAAAGTGCTAAAATCAAATACCTTCGACGGTGGCGCCCCGTTGCTTGTATTAGTGCCTC
CTCCTTCCAAAAGCGAGTCCACGCCTTCTTCGGAAGCAAGAAGCAGTTGAAGAATTGAGAACATGCTTTCTTTTGCAGCCACGTCGCGCCCATATGCACA
GCTTTCGACTAAATTGAGAATAGTGTCCCAGCTGCCATCGACTTTTACCAATAGCGGACCATTTTGTGGCGCAACAGAGAGCAATCGCCGCAGCACGCTC
ATCGCCAAACTACGAAATTTGGACTCCCCCGACGATCGAGTCGATAGAACGCGAACGAGTAGGTCCAGCGTCGAAGACTCGTATGAAAAAAACTGGTATC
CAAACTTGTCCAGCAATTGCAATTGTGCCTTCAAAACGCGCTCTATGACTTCGTCCGATGTACGCCCACCATCAGCTACGTCCCTGCGCTCAAGCAAACC
ATTTAGTGAATCGAACGCGTTGCGCACTGTCGTTACCTCGACCTCTTGTTGACACAGTTCACGAAAACGCTGACGCAAATCCGACGACGCGTACGTCACA
CCTTCACTCCACCCAAACACCTTATATGCATCCGAGTGATCTGCATCCTGATCAATCCCATCCGCTTGATGGCGTACCAAGTACCGCCACTTCTCCTCGA
TACTCTTCATGAGGAATACAGGGTCTTCAACCTCCTCTTCAGTATCAGAATTTGACTGATTAAAAGTTGAAAGATAGAACCCACTGCAGTACACGTCTCC
AGACAACTCCAAGAAGGAAATTGGCGGGATTGGAGTGTAGCTGTACCTAACAGCAACACTTTTTCTGAGATCCTCTTTGAAGTCTCGCAGGTGTTCAGCC
AGCATCTCTTGTAAATGCACTCGCATCGTAGATGACCACATTACGCGTTTGTCTTTCTTACGACCAATAAAAACATCGGCAAAGTGTTCAGGTGGCTCTG
AATCCAGAATATTGATGAGGGACTCTGGAAGCATGTCCGTCAATTGACTCTGTCCTGTGTGCAGCTCCGATGATCGCTGAGTACGATGAACTCTTTTAAG
AAATGCTGCTTCTGGAACGAACGCAGGCACTTTGTCCGCTTCTCTGGCAATAGCGACCGTAGACAATATAAAGTAGAAGGTTCCATACTGGTGTAGATCT
TGCAACTCCCCATCACTCAGTGACATCAGCATTTCACACACGTAACGCCGCACGCTCGAGTCATTTACAAGCAGCAGCTGGATCATAAAGGCCAACGATG
ACGCATTAGCTACGACGGTATTCACTAAGGGTGGTGGCCACAAATTTTTGTTTCCAATCGACACTGTGTGCTGATCTTTGATCATAAAGTTCCTTAGCGT
CTTCAAAGCATACGCAGCACATTTCGGATCCATGGGTTCATCAGTCAGCTCCATCCAGCGCAGTTCTGGGTATTCAAACATCGACTTCCACGTATGTTCG
TCGCCATCTGAACCCGTGTGTGTCGAACAGCTACACACGTATAGGGCATCAATTTGGCGGTGCCGAATGAGAGGATCAGCTTCCAGATATTCCTTCAGCT
CGTTCGCCGAGTATGGGCCATTCACCTCACTGTTTCCCTCAGCATCCCCCACTGCCTTAAGCTTTATGCTCCATTTGAGCGCAAACCTGGATTCGTCGTA
CAGGGAAAGCTCTGCAATCGGAACTGAGGAGGTTGCGTCAGCTCCCGACATGACCAGTGAGTCCATCATCGGTATATCACTACGATCGTCCGTTACTTCA
CTCCCTATTGGTGCAGTCCGACGTCTGTGAGACAGCATCGACATGTACAGTAACACTTGAATGTAATTTTTAGTACATAACTCAGCGCAAGCCTCTCCAG
ACAGGCTCAATCCAGATATTAATTCGACGACATCTTGAATTTCACTCGCAAGGTATGAGTTCCGCAGAAGTTCGATGAGAAATCGAGCTCGATGTTTTGT
GATAGGTCGAGCTTCGGGGAACACATGGGCTAACTCGATCAATATTTTCAACATCGAGTGGCCGTGTTGCTCGCTTCCAGTTCCTCCAGTAAAATGCGGA
AATCCGTTGCTTCCACTTGCAGACCAATCGTTAGTTCCAGATAGCGGAATATTGTTCAGATGAAGATGTTCCAGCCAACACTGATAAACCTCGCTGAAAA
ACTTTGCCGGGTCCTTCGCAATATCCATACTGGCGAAGAAAAGGCTACTCGAGTTTTTCAACTTTCCACGATGTGTTCCTGATTCCATCGATCGAACAAT
TTTTGCGACTTCTGTCAACTGCAGAGATCCATCGTTTATTCTTTCTGTGATAACACGGAGGTAAAATCGATCAACCTGAAGCTCTTTGGAAATGCTTTCG
TACCTCACAGAAAATTGTGCGTGATTCCACTTGGGCTCTCTACTTCCTTTACGAGAAGCAACCAAGGATAGTGCAGCGGCTTGGTTAGCTTTGAACTGAT
CAAATTCGTCGATCTCCGATTTGAGAGCAGCCTTCAGCTCACCTCGTGTTAACTCGTTCCAAATTAAGTCGGGGAGAAAAAAATCTTTGCCGACCATACT
TGACAGGAGCGCCATGTCAGTGGATGATTCGCCAGGATAGTTCGTACGGGAAGGATCCTCCTTGACTCTCGCTTCTTTTACTGACCCACTTGCAAAGAGT
GTCCCGATTTGAAGTTGCATCCGACGGATAAACCACTCCGAGCCGTCAACTTGATCCTGAAGCTGGTGTTTGCTCTTCCGCCTGGACTCTGTTTGCCGAG
CTCGCTGTTTCTTTAGCAATTTCCGTACCATTGGGCTTGAGATCATACGAATGAAACCATGGGGAAGGATCTTCACCAGCATCTCATGAGAGGGTTTGTG
GTGGGTAACCCAGATGCTTGCGATGTACTGATACGTCTCCTTCGCATTATCCGAGGGGTGAAAAAAAGCCTTGCGCAGGTGTTTAATTGTTAGGCCGGAA
TCTAGCGCAACGTCACAAATGCGTCGCCTCATCTTATGATCACCGTGGTCGACGATCACCTTTAACACGCAAATCACTGCCGCTGCTAATCCTGCATTTA
CACTTTGAGATGCCAACTCCAGCAGCAAGGTATACTTTCCTGCAAGAGCTTTTACCAGAGCATCAAAATGATTATTATCAGTGCTGTGCCGCGAAACGAC
GAGCACATCCAGCATCAGTTGCAGCATAACCAACGTGGAACTTGGATTTCGTTGTTCCAGGAGACCAGTCAGTAGCGAAATAAGCTTATTGTACTCAAAT
ACTTGAAATCGAATGTCCTTCTCAGCCGCCCGATGCGAATTTGATCGGGATTTATCAGCAACCAGCGAGTGAAGTGCATTCACGGCCCACACAGTTGCAA
TCGGGTCACCAGAGACCAATACTTGAGCCAGCGTTGGAACTATTGTCATAGCACCGCCGTTCGACTGCTCCATTGTAAACCGATAGCATCCATCATTAAT
GCGGCAAAACGTTTCCAAGATAATACAAACTTCGTTCGCGCGAATTGGTGGCTTGCAGGAGTGTTCAAGCTGCACCGAAGCCATAATAAACAAAATGTTA
GAGGTCTAAACAACAAAATACTACGCATAAGTGCAATTCAGGCCCACTTACCAAATTATTTACCCCACGAAGCAGGGACCCGAATGAAAGCTTTTCCAAA
CGACCGCGCATGGATTTCCCTGCAAAATCATTCGTCTCAACATTCATATTCAAGCTCTCGAGCGCAAACGTGATCCTGTTAGTCGCAGACGTGATACTCA
CGCCTTCCCCACCCATTGTTTCAATTTCTTTTTCCAGAAGTACGTGAGCAGGAATGTATAGTCCGTCATGGTTTAGATAGAGAAAGTTCTCCTGCTCGTC
CTTTAACAGTGCTCTGGGAGACATTCTCGGGTTTAGGTTGGGAAACTCGCGACTAAGCGACACATTAAAATTATCGACATAGCGATATCCGTCATACAGC
GCTGCCAGAAATTTTTCAACATCGTATGGAACGTAAACCACGCGACTGCAATCCGAAAATTCCAACGCTACCATAGCCTGAGCGTCAGTGCTGTCTAATC
CAGGGGTTACAACCCGCCGCAAATTCTTGAGGTCGTACGTCTTTTTCGAGCAGTCAGTAAGCTCCTGAATTGTTCCATGTACGAAGCACAGCTTCTTTTT
CCGCAGATGAGTAGATCCATGTCGACCTGTTCGTCTTTGAACGTCAAAAACGTCACTCGATTCAAGAGCACATTGGTCAAGAGCCTTTTCAATGGATTGT
TTCGGCAGCTTGTCCCGAGTTTTGAATCGTAGATGGATGCCAATGACACCAGCTAAGGTCTTCATTTTCGTCACAATATCATTGCTTTGGTCGGAATAAA
TAAATTTTAGCTTTTTCTTTGCGGTCAGTATGAACGCGTCTGGGATGCTCGCGGCCTGCGTTATTTCTTCGATGGTGCGGTATTCAAATTCATGAGTGTG
TCGATTTAGAACCCGAACAGCGATTAGAGCGCGTGGTGTCAGATAAAAATTGGTCTTTTCTCGCTGTCCATCTGCTGCACCAATAAAGCCGCTGAACTGG
CAGCAGTCTACGCTGTACACGCGTTTGAATTCCTCAAAGTTACCCACCAAATGACTCATCAGCTCCTGCAGAAAATTATTTCGACATCGGTAGCGGAGGC
GTAAAAATACCGGGTCATCGTATTGATCAATGCCCATCTTCAGCGACCCGCACGCAGATTCGAGAAACTGCCGATACTGCCGCAGCAGTACTTCAGGATT
CTGAACCACTACCATGCTAGGTGCAGTTCCATCATTACCACTTGATAGCGACTCTGACGACGAAAATGTGTTTCGGCTGGACGAATAGTTGTTTCGTCTA
GACGAAAAAATGTTTGGATGACGAGAAAATGGTGCGACGGCTCCGCGTTGGCTGTTAGGCCCGAAATTCAACGTTTCTCCGAAACTGAGCGTTTGCCGAG
GAACTTGCCCGTCATTGGACCGCAATGGGGAACCCATATTACCAAAGTGCAAAAATGCTGGGGTTTTCGTCATCCGGCTCAAAATGCCGACGCACGCTTC
CACTGTCGCCAAGCCAGGAAAGCTGAAAAGAATTCGAAGTATCATTCGGTATTTCGTTGCTAGGTGTTGATACAGCGTTTCAGACAGTTTTCGCTGCTTT
TCGATGTTTGCCTTGACCAATAAAAGAATAAACTGGCACAGCTTCATTGTCGGTAGGTCGGATAAGAAAGACCTCGTCTACATAGCAAAGCAAACTCGTT
AGAACACACATCGCTAAGGCCCAAACATTTTTCGACGTACATGAGTGTCTTCATCTAACAATGATAGAAGTGTCATGACGAAAAGACTATTTGATAGCAG
GAGCTGCCGACACGGCAGCTTATGCGCCTTGGACTCCATCAATCGGCTCAAGACCATGAACATCCAGTAGATAGCCACGGAGTTCTTGCTCACCAATATC
TTCGATATCATGATCATGTACTCTTCTCGATGCTAGATTGAAAGCAAAAACAAATGAGTAAATTAAATGATACCTCGCACGACATGTGAATGCGGCGGTC
ACATGTACCTCTGTCAGAATTTGCATGAACTCGTTGATCGCAGGCGGTGCAAGCATCAACCGATAGAGTGACTGGAGATACGTGATCACAAAATCCTGAT
TTGCTCCGTGACGTTTTACAATGTCATTGAGCTCACGTGCAAGCACATACAGCACCCTCTCGAACGGTTTGTTCGGCTGGGCAATGACACCAGAAGTCGG
CGTATTTGCGTTTAGCTCCGCCGCCAAAGAGTGCATCTCTTCGTCGAGACCTCGAGGAAGCTGGCGCTGAAAGCGCTCTGTCTTACGATGGCCATGTACA
GACATTAACTGCAGAATGGTTGCCTGGGCAACACGGAGCTCGCGATCCAATACGTTCACATTCGGCACAATGTTCGCGATCTTGTTGCCTTCCTGCAATA
TTATCTTTCGCGGTATCATACGCACCCAGTCCGGAACCTCCATGACCTCCACGCCCACTTGGTAATTCCCTAGTGCATGACACGACGCCAAAAGTTCGCA
TACGATCTTCTCGCGCTGGGCAGAATAGTATTTGCGCTTGATGCCATCCACGTACACGACTTCAAACGCCTGCAGCGTGTCCTGGTACATGATGAGGCTG
TAAATGCGCGACAACGGGCGACTGGAGATCACCGTCGTGGCGTCTACGTATTCCGTAATATACTTTTCCGAGACGGACAGCGTCCGTGGGGCAGCGCTGG
ACTCGTTCGACTGCGACACTTTGAGCACTTGGTACTCGAACGAGACACTGGTGGTCGACGAATCTTTCCCGTCATCTTTGAGCGCAGCCTCGATGGTTTT
CTTGCGGTACTCGTTGATCTGCATACCGTAGGCCTTCATGACTCTGTCGATAGCCTGCGCCAGCTCTGTGCGTCTCGGCACAATAAACAAACTCGAGTTG
TCCGAGTGGTTGAGCGCGATGGCCTCATGGTCGTCGCAAATGAGGTCTATCGAGACCAAACTCGTGTACGGGATGTGGCTCATGAGGTCTCCCTCCGTGT
CCTTCTGGTAGATGCCGTCCGGTCGCACCTCCACCACGCACGTGGACTGCACACCGCCCCTGTGGCACTTGAGGCTCTGGAACGCGTGCGTCTGCAACTC
CAATGGCGGCGGTTGTCTAGCGTCGGGCGCCTTGGCGTAGTGTTGGCTGCGCAGCCGCATGAGGCAGACCAGCACCTCCATGCGGAAGTGGCAGCGGAAG
ACCGTCTTCTTGATGCGGTGGCGCGGCGTGTGGATGACCAGGTCCGTCTCGCCCTCCAGCACGTTGGCACCGTCCACGTCCTCGTACGGCCACGTATTGG
TCACGTGCTGGTTCTCTCGGTCCAGCGTCCAGAACGAGTACTCCCCAAGGCACAGCACACGCTCCTTGAGCACGAAGCTCCCGACCTTGTGCACCATGAA
GCGCGCCACAACGCGCTTCATCTCCATTGTCGAAGGTTCTTCCCCCGCGCTCTCTCGCTGTGAAATTGCCTTCTGCCGCCTCTGGATTCTTCGTACGCAG
CTCGATCTTGCTGGCCAAAACACTTAGTGACGGCAGAGAGCGTCGAAAGGTCGCGGATTCTGAAGTACAAGGGTTGTTCGTTGAAGTACGATGGTTGGAG
CAACTTTGTGTGGCGCAACTTAGCAACTACAACTTGCCTTTTTCGTGCTTGACTTGCTGTTGCGTACAGCTCTGCGGTCGATTTCCGTGCTGAAGGAGGT
ACCGACGAAAGAGGTGCGCATTTCGATAGCAAAGGAACCCTAGACTGTGGCACGTAGAGTAACACTGATAGAGCCGGCTTCGGCACTGTAAATCAACTTC
CCCCAGAGATTGCTTTAGCGCTGCGCGCAGCAACAATAGTTTTCCACGTGACAATGGACAAGCAAATTTGGACTGGCCGCAACAATGAAGCAACTTTGTG
TACTAGCAGGAGCGAGATCGTTTAGAGGCGTCGTGAACTTTGAAGGAACTCGCGTTGTGCTCTGTACTATCCGCTTGGGAATGGACGCCTGAGGGATCAG
CACAATCATGCTCTTAGACTTCGTCATACTTTCCACTATTTCTCCGTGTGTGGCGCCGCTTATATGATGTTTGATCGTGCTTGTAGATTTCCACCGCTCT
TCAAAAATAAGCGAGTGATCTCGTCGTCGTCTGGACTCGAACTGTATCCTTAAGTACGATACCCGTTTAAGTCCGTGTCTTATTGCCTTGAGATTGTATG
GTTCTTACTAAAATCAAGTCTTTCGCGGGTTTTGGTGGTGAGCGGCTCGATGTGCGGCTCTGGGGCTCTGAGCACAGAAACGCGTTTGGCGCTGCACCCC
CACCAAGTCCCTACCAAGATGCTCGCGTCGTCGTCGTCCAAGCTCGCGGCCCGCGCGTCGCGCTCGCTGTTCACCAAGGCCAGCGCCATGCCCAGCGTGG
CCCTGAGCGAGGAATTCCCGGCCGTGCCCAAGACGCAGCCGCAGGCCACGGCCGCGCCCAAGCTGACGGCGTCCAAAGCCTCGTCGGGCTTGGCATTGGG
CTCGGACGACCGCGCGGCCCCCGTGGCCACCATCGGCGTGCAGCTCAGCACCGGGTCACGCGACGAGAGCGAGGACACGGCCGGTGTGTCGCAGCTCTTC
GCCAAGATGGCCTTCCGTGCCACGGCGACCCGCTCGGACCTGCGTCTGTACCGCGATGTGGAGGCCATCGGCGGCGTCGTGCACGCTCAGGCCGGCCGTG
ACTTTGTGCGCTACAGCGTGAGCGTGCTGCCCGACCAGCTGGAGGCGGCCGCCGAGATCCTGGCCGAGACGACGTTGGCCCCCAAGTTCGCGCTCTACGA
CGTGGACGAGCAGAAGAAGATCGTGCAGGCCGAAGTCGACCGGATCGGTGATGATGCCTCGGCGTCGCTGCTCGAGGGCCTGCACGCCGCCGCGTTCTAC
GAGGACCTGACGCTGGGCCGCCCCGTGGCCGCCGCGGACAACCTCCAGGCGCTCAGCCCCGAGGCGCTCTGGGCGTTCCACGACAAGTACGTGAACACGG
CCAACGCCGCCCTCGTGGGAGCCGGCGTGAACCACAGCACGCTCACGGACCTGGCCAACGAGTACTTCGGCTCGTTCGCCAAGGGCGTCGAGGCCGCCAG
CGCCACGGCCAAGTACGTGGGCGGTGAGACCCGCGTCAAGAAGGCAGCCAAATTCACGCACGTTGCTCTGGCGCTGCCGACCGTCGGCCGTGACTCTGCT
GACTTTGGCGCCTCGCAGGTGCTGCGCGCTCTGCTGAGCTTGCGACTCAACAACAAGAAGGCGTCCGCCTTCCTGTCCAGCTACAGCGACGCCGCGCTCG
TGGGTCTGTCGGGTTACGCCGTCCACTCGGAGGCCGGCGCCCTGGTGGACTCGTTCGCCGCTGAGCTCAAGAAGGCTGCGTCGGCTCCGGCTACTAAGGA
GGAGCTGGCCGCTGCCAAGACCACGGCTGCGCTCGAGGCTCTGGAGCAGTACAGCACCCAGACGGGTACCCTTGGCCGTGTGGGCCTCATCGCCACCACT
GGCTTCGTGTCCCAGTCGCCGTCGGCTCTCGTGGAGGGCGTGACCGCCGCCAAGCTGCAGGAGCTGGCCCAGAAGGCTCTGAAGGCCACGCCGTCTGTGG
CGGCCATTGGCAAGCTGTCGGCCGTTCCCCACGTGGACGCGGTGGCCAACAAGCTGCAGTAAACGACCAAGACGATCGATCAAGAGTGAGGTACATACAT
CAGTTTAGCACTCGGAGCTTTTGGTGATGCACGTTGAAGTGACCTTGGCGTGAGTGCGGATGAACAGGACAAGACAGGAGCGTTGGATGTGGAAGCAGCG
CAGAGACGCGGTAGAAACCTCGAATTAGGAAGGGGGCATACAACGCTGGCGAGAGGAGAGGGCTGCTCAGACACACTCGTAACGCGAGGTGACCGATCGT
GCGAATATCGCACTAAATGCAAGAAAAAAGAACCAACTTTTTAACGACAAATGCTCGGTCAGCGGAAGCCGTTGCTGTGTTTCTGACAGTTCGATTCAAT
CGCGCAAGAGCTGGCAAACGGCTGTAGCAGGA