Description :
From Genome Similarity Track
Location :
Scaffold_431:18037- 23094
Transcript NameFunction/comments
Phyag_g5655hypothetical protein
Phyag_g5656hypothetical protein PHYSODRAFT_345496

Sequence
5057 bases(100 bases per row)
TTACGttgacgacttcaacttgagctgGAGGTGACCGCCGCCTCTCTTGACGGCCTCCTTCCTCGCCTTCCACGTGCTCTCCTGCCCTTCACGACGCAtg
gcgagctccagctcctgctcgagATCGTTGTTGCGGGCGTCGAATCGCTCCAGTTCCGCCAGTGCGATCCACTCGAACAGCGGCACAATGCTCAAGGCGC
TCGGAGCCAACAGCGTAGCAGCCACTTGGCGAGCGAATCTCACTGCACTCTGCGGGGTGGGGAAACACTGGTAAACGTGCACCACAACCGCCTCGACACA
AGCGGCCCCAGTCGACAGAAGCGAGACGCTGACGCACGCGAAGCGCTGGCCCGTGGCTTGTGGCAGATCCACGGCGCTGAACTGGGACTCGACCGAtgca
ccagcttcgacaCTGGGGAAGTTCTCTAGAGCCATTGTCATTTCGTCTTCCTTGTAGATGGCGAAGCGACTGCAGTCATGTCCACTCGACAGCcccgccg
tcgtctccaccgcGCAGATCTGCCGAAACAAATTGAGCGCTTCGTCGATGTCGCGGAATTTGCCAAACACGCGGAAGCGCGTGAACTCCATGCGGGTTGT
TGAGTTTGCGCTGGCAGTGATCGCCGCTTTTCGGAGCTGGTCTGCAGCCGATTTGGCGGACCTGGTCAGTTTGGCGGACGACAGGGACAAGGAGATTCCT
CGGGAAGCGGGTCGAGCTATCTGTTCTTTCATGAATCCAAGTACGGCGAAGGGCTGACACACACCGTGGATAGGGTCCCAGATAGAGGCTGCGTTTGCAG
CGATGCCGGTGAGAACTCcagttcctgttgctgcgttcCTGTTTGCGTTGAGGGTGTTTTCGGTCTTCTCAGTGCGAATGCGCCCGCAACGGCGCAAGTC
GCTTCGATActctttctcttcctcctttgAGGATCCACGAGTTGGAGACACTGCAGGGAGCACCAACACGTGAGTGCTCTTGTTTACAAGACTGGTCTTG
GACACTGCGGTCAGACGGCGGTTTAAGGATCGATTGGTACCGGGCCCAGTTAATGGTGTGGATATCGAGTCCTCCTGCTCGGCGGTAGGCAGCTTCGATC
GACTTGCGCGTTGCTGTAACTTTGAAGcggacgttgctgctgccggtgacatcctccgcagcagcaggggtCCAGAAGCAGACCGACTAACTTTTACATG
CCCATCAGTGCTCTCCCCGATGCACGGCGGGGACGAAGAGCTTCGTCCTTTGTTTGAATCGTCTTCAGGTGATGCGGGATGATCACCTACTTGGGTTTCC
TTTGCGGTCGCCACACTCAAATCTTTCTGCACTAAACTACCCGGGTTTCCATTCGTCACAACTGTTTGCCGAGAGATGTTCGTCTTGGCAACCCCTTTAC
GGCGTTCAAGCAAGAGAGTACCTGGAGCGACCAGCGATCGAACGTCGCTAAGGGGCAGCAATGGAGCAGACTGGGATTTCCCTAGCCCAACATCGTGGGG
AATGGGAGCTGAATTCTCATCAAAATACTCCGAGCCATCCCCAAACGGATGGTGGTGACTTTCAGCCATGACACTGGCGATGAAGGTCTTCTTGTACTTT
TCCCATGCTATCGATTTGAGCGCGCGACTCTGGATGGACTCTCGGATGTAGCCGTTTGACGAGCGCTGGAGACTTGCACGGGCCTCTGCCGACATGAGGT
GGAAGATGTCGAATCGCGAAAGTACGAGGATTTTCATGGGCGATTCCGCCAAGATGGAATATTCGCGGACGAAAATGTCGTTAAATCTCCCAGCTGAAGC
TCTGCGGACAAAAATTCGTGTTACTGACAAGTATCGAGGACCCAACATGCACAATAATGCTTACTCTGCGCAGCCCAGAACTGAGTTCGGCCCGTATCTC
CCCAGCTCGTAAATCTGACGAGCATTAGTGATGGGGTTCTTGCCTTCATGAATAACCCGACACTCACCCCGGGTTACAATGAAGAGCTCACTAGCGCGCG
ACCCCTACTACCCCGCACATAACAGGCGTTAGCATGCTGAAATCGTTCAAGATACCGTGGAATGCCAACCTGCTTGCAGATTTCGCCCTTGAACGGGATA
TACTTCTCCGTCATTACAGAGCACATGCCTTCAATGGTATTATCGTCCCACTCAGGGCCGATAAAGTACGGGTTCTTTCGTAGCATCTGCGCGTACTGTG
CATGGTATTCGTTCTGGTACTTCTGGATTAATGGTTCATACTCCTCACGACCCAGCACGAGTAACTCGCAGAACTCGGTGCAAACCACCGTAGCACGACG
AACGCCGTCAGCCTGCGAGAGAGCCAATTCACCGAAATACTCGCCCTCTCCAAGTCTCGATACAACGCTCTCTTTTGTCTCTTCGAAGCGGTTCTTCGCG
CGAACAGATACGTCCACACAGCCGGTGAAGATAATGTAAAAGTGTCGCCCCACTTGGCCTTCAGCAAAAAGCACAGTATTGGTGACTGCACTAACGAGCC
GCATCACCTTACAAAGCTGTTTTCGGACCTCAAACGAGAAACGAGAGAAGAACTTGACGCTTTTCAGGTATTCGACGGCGAATTTCATATCCTTCTCGGA
TCGCTGAGTGGAACTTCGCATGAAAATGTTGCGCACAATGTCTTTGTTGCTACGGAACCTCTTGGTAATCTCGAGCGTCtgggcgttgctggagtcATGC
GATTctttcagcagctcgctgaATACGACACGGTTGATAAATACTAGCTCCGTTGGGGCACTCACGACAATCACGGAGGCTAGACGACAAAAAAGGAGTG
AGGACGGTAAAATGCAAGCGAGAATAAGAACAGTAGCGCCTTACCTGCGCGTACATCAGTGCTGGAAAGCAAAGCTCGCTCCCCGAAGGTATCTCCTGGA
CCCAGAAAGATGAGGTGAATTGTTCCGTTTGGTCGAGCTGGATTGTTGACCTCGTTTTTCACTACCTCCACTGTTcacaacagcatcaaaacGTCAAGTG
GCGCGTCCGGTAGCTGTATAAAAATTCTTGTACACACCTCGACCGGAGTAAACAAGATAAAAACTATCGCCATCATCACCCTGTGTAAAAGGTATGCACG
TGACAGCATTTTAGTGAACATATGTCTTTGGTCACGAAAAGCTAAGCGCCGATGCACCTCGTGGAAGACGAACTTCCCCTTTTCAGGATGCACAACTATC
TCCAGAGATTGATATAACCGATCAAGCTGCCCCACAAACAGCACACCAACAACTTGTCATCGAAGAGATTCACTACTACGGAGCAAGCAGGAAGCGCACC
TTAACTGGCAGTAGGCACAGAGAAAGCAAAGCAAATAAGTTATGGTTAGCCCATGCTGCTTCCCCAGCCGACTTTAACTATACAGAAGGGCATCAACACG
AACAAGCATCGaggttggagaagaagtcgagcagcttggatGACGCGAAGAGCGACTTGAGCTGGGAGACCATGAGCAACCGTAAGCTGCAACTGCTAAC
AAACCAGTACAAAGGCCAACGCACCACGTGGATGTCCTCCAGCGTCCGCTTCCCCGTCGGCTTGCGTAGGATGGTGCGGCACATGGCGATCTCCGGACTT
TTGTATTGAATGGCGCGCAGGAAGGCGCCGTCGCTGGCCATTTCCTCCATCTGCGAGGCCAGCGACACCttgcgcctgctgctcgcccCATTGCCATtcg
caccagctccagtgccgctttcctcctcctccatggctAGAGCAAATATAActgaccacttcaactcgtAAATTACATTAATTCACTACAAAATAATCTA
ACTCGTTACGTTTAGTCATTTTTCAAAATGGCGAACGAGagctcgccgtcgtcgctggtcaATGACGCCGTGCATGAGCTACGACGGCACTTCGCCAGCA
ACCGGTCGGTATCTGTTTACGAGGCGCTAACAGCGCACGTACTGGACGCAGCTACGGGCGGCGCCTTGTTCCTGGGCGGCGTCTCGGCGGCGCAAGtggt
gcagaagctgctgcgcatcGGCTCGTCCTCGGGTTTCCTGCTGCCTCAGGCGGTGGGTGCCGCCGctgtggcctcgtcctccgtcgtggcgctgcacttc
gcCTCCATCCCGAGGGAGATTTATCAGGAACTGGCGGCGCAGAATCGACGAGCgaatgagcagcagcgacgctggagctcctGGCTCGTGCTCGGCGCCC
AGAATCTGCAGCCGCCGACAGCCTGGAAGCAGGTGCAGAACAAAGTGCAGCAACGCTGGGAGGACCTCCCGCAGGCCCCATACCCAGTCTATATGGTTAT
GGGGCTGCTgtgcttcaagctgctgggagGTCGCATGAGCTCGTTGGCGCCGTCGCCTTTCGCCAACCTAGGGGCTTTCCACCTCaagatggcgtcgctg
ccggcCACAGTCGATTACGCTACGAACGTCGAGAGAGGAATCATACAGGAGTTCGGACGACTCTACGGCTGCCACACGTGCGGAGTTAAGCGCGGTGTGC
GATACCACGCAGACCACATGCCGCCCAAATTGTAGGCAGCAATGgcgtttttcttcttcgtggtctCTGATTCTGACTTGCTGTAATCGTAATTTCCGGA
CATGTAGGGTGGCAAAGCGTACCGATGAACAGCTCTTCCGACGGATTTTGGGCCGAAAGACGACTTTCCGCTTTTACCCGCAGTGCGAGCCGTGCTCGAA
CCAACAGGGAAGCGTCGTGAAACAGTGGAAGTCGACGCTTAAGATGCACCTGTTGTCCTTCCGAGCGTACCATTCCACTGGTCTGTGGCTTGTATTACTC
TGCACTGGTGGTCTCTATGTAGGAGGTTCCAACTTCCACGAGACGTCTGAGGTATCAGCTCCAATGGATGACGTTTCTGAGACCTCTAAGGCATTTACGT
CGCCCGATTTCTCGCTGCTAGTTTCATTGCGTGAGCGAGAGCGGAAATTGCGTCGTGAACGAGGAAACCAGAGTGATCCGCGTCAAATTGCTGCGATTGA
CAGAGAGCTGAAGGCAGTGACCGAGTGCAAGGCGGCCGTCAAAGCCGACATCAAACG