Description :
From Genome Similarity Track
Location :
Scaffold_38:180357- 182336
Transcript NameFunction/comments
Sapdi_VS20SDRG_1089650S ribosomal protein L36e
Sapdi_VS20SDRG_10897hypothetical protein

Sequence
1979 bases(100 bases per row)
AACTTTGTGCATTCAGATTAAGATCAACGAGGTACTTCCGAGCGTCGTTTTGGTGAAGAATGAAATGAGGTCGTTTAGATACCGGCTTGCTTGGCGCGGA
CGGCAGCGTAGTACGCCTTCATCTCTTCGCGCTTGTGGAGCGCGCGGCGGTGCGTCCCGAGGCGCTTCTTGGTGAACTTGTAGATGCGCTTCTCGGCCGA
CGAGCCGCCCGACTTGATCATATCAAGGATGCGCTTCTCGTACGGCATCAAGCCGACGACTTCGCGGACAATGTTGCGCACGAACTGCGTCTTCTTGCCG
GCGCGCTACACATCACATGGCACATGAGCATCGTCCTCGTCATGCGCAGGTAGGGAACGTACGCCCTTCTTGGCGGCCGGGCGGGGCGCGACTTCGCGCT
TGGTGACGGGGTACCCCTTGGCGACACCGCAAGCAATACCGGTGGAAGACATCTTTCTCTTTACTTTCACACTAAAACTGAAACTTGGAATAGCTCGTCC
GTGCCTCCATGCCCATGGACCTCGCCAACCAATGCTTTCCACCAATCATCTCGCGTATTCGGATACGTCCGGATAAAGGACCTCTCACATTGGATGACAA
TACTCTCAGACTCGATATTCTCACACTGGCCGTTCATTGGGTCGTGTCGTCACCACTCAATGGCCTGCATCCCGACATGAGTAGTGTAGACACACTATTT
CAGACTTTTCATCTTTCCGCCGGTGCATCGCAGTGCTATGACACTGGAGCGTCGTCATTAGCACTTGCCTACGGCGCTCGGTGCATAGAGCAAGCGTAAG
ACGGCGTGGAGTCGGCCGCATCGTGGATCGCAGGGGTGTACGCTGCGGTCTATTCGCTGAAGATGACACTATTTGGCGGACGTGACAGCATTTTGGGCGG
TGCGCACGCGCATGGTGCACTGTGCAGCGGGGTGCAACCGAGCGGTTACGGTTGATGCATAACCGGCTAATTATGCGGTTTGGGAGGGCTTTTCTAGAAT
GTCTTGACGTAAGCATCCCATACAAATCGGCTGTGATCTTGGGCGTCATTTTCCTATCTTGCAATCTTGGATCATGTTCGGTTCCCGTGGCATGTCGCGT
CATGCGGACGTGCTCGAGCGGGCGGTCCCGACGGCGCCTGAGGAGCTCGGTCGCCTCGTCGAGGAGATCAAGCGTCGTGGCAACCAAGCCTTCTCGGCCA
ACATCCTCGAAGAAGCCGAGATCCTCTACTCGCGTGCGATCGAGATTGCGCTCCCGACGATGAGCGTGCACATCTTGCACAGCAACCGCAGTGCGACGCG
CCTCAAGATGGGCAAGTTTGATCTTGCTCTGGAAGATGCCGAGGCCGCGACGACGATGGACGCGTCGTTTGCCAAGGGCTACTTCCGCAAGGGCCAAGCC
CTCGTGAAGCTCAAGCAGTTCTACGCCGCGATCGAAGCGCTCACGACCGCCGACAACCTCGAGGCCAACAACGCCAGCGTCAAGAAGGCGCTGCAGGAAG
CCATCGCTCTCCAGGCGGCCGCTGGCACGACGGCCCCGCTCTCGCCCAAGACGAAGACGGTCTTCAACAGCACGACGACGACGACGACGACGACGACGAC
GACGGCCAAGCCTGCCGCTGCGAAAACCGTGGCCAAGAGCGAAAAGGTCGTCGTTGACGACGACGAGGAAGTCGACGTCAAGGGCGTGCGCGGCTACAAG
AAGTTGGCAGACGGCCGTGTCACGACGTTCTTCAACAACGAGCTCTCGGAGGCGGACAAGGCGCTCATCGGTGACATCGCGCCGCAGAAGATCCAAGACG
TCAAGGCCGTCACGATCGCGGCCGTCGAAGGCGGGTCGGCGTGGAACCAAGGCAACACGTTTGAAGAGCGCGATATGACCAAGTTTGCCCACGACCGCGT
CTCGGAGCTTGTGCGCGCGACGGCCCCGCAGCCGTGCACGCTCGCCGGCGCGCCCGGTCTCCTCGTCGTCAAGGACATC