Description :
From Genome Similarity Track
Location :
scaffold_477:18033- 20069
Transcript NameFunction/comments
Pl_104528myosin-like protein

Sequence
2036 bases(100 bases per row)
TACCTCCATGAACCTGCCATCCTTTTCAACCTCAAGCACCGTTTCTTGCGGCAAATCCCATACACATACACTGGCGCCATTTGCATTGCCGTCAACCCAG
TACGTCGTCCCACTCTCTTACACCTCAATCTGAGTTCTAACTCTGGTGTTGTATAGTATTCCTGGCTTGATATCTACACCAAGGAGCTCCAGGACCAATA
TCTGGAACGTGATCGCAGTGAATTGCCTCCCCATGTGTACGCGACCAGTGCTGGAGCGTTTCAACACATGCGAGTCTTTGGTGAGGACCAAAGTATTCTC
GTGAGTGGCGAATCTGGAGCTGGTAAGACAGAGACTACCAAGATTTTGATGTCTCACTTGGCATCAGCTGGCAGCCACTCCACCTCTGATGCTCAGGCTA
AAGAGGCCAGTATCATTGAGAGAGTATTGGATGCCAACCCTTTGATGGAATCTTTCGGTAATGCCAAGACTTCCCGCAATGACAATTCCAGTCGATTCGG
TAAATTCTCCGAGTTGCAATTCGACACATTGGGTCAATTGATTGGTGCTCGCTCTCGCACTTATTTGCTGGAGAAATCGCGTGTGTCATTGCAAGGTCTG
GGAGAACGCAACTACCACATTTTCTACCAATTACTGGCTGCACCTGAAGATGTGACTACTGAAGTCATGGTTACGGGCATGCAAGCCAAGGATTTCCCGT
TCATCAAGCCTCATGATGAAGATCTGGCGAAAAACATTGATGTCAGCGCTGGTTTGAAGGATGCAGAGCGTTTCCAGCAGACAGTGTCGTGTTTGGAGAC
TATGAGCGTGTCCAAGGAGGACCAGATGAGCATTTTCAAGGTTGTTGCGGCCATTTTGCACCTTTCGCGGTTGCAGTTCGAACCGATGCCTGGAAACGAT
GACGCTTCGCAACTTACTGGCACGCCAGAGAACCAAAAGGCTAGTGAACTTGTGTCTCAACTATTGGAGTTCGATGATAACCAGTTGCACACGGCGCTTT
GCACACGTGAGATGACGGCTGTCATGGAGACCTGTTGGAGTTCGATGACAACCAGTTGCACACGGCGCTTTGCACGCGTGAGATGACGGCTGTCATGGAG
ACCTACGAAGTGCCTCTGAACGTGTCACAAGCTGAAGGAGCTCGTACTGCTCTGGGTGTGGCCCTGTACTCACACATGTTCTCGTGGTTAATTCACCGTG
TGAACATGTCGACGAGCGCCCCCCACGCGGATGTGGCTCACAAGATTTGCATCTTGGATATCTTCGGTTTTGAAATCTTCGAGAAGAACTCGTTTGAGCA
GTTGTGTATCAACTACGCCAACGAAAAGCTGCAGCAGAAGTTCACGCAGGATGTGTTCAAGTCCATCCAGCAGGAGTATGAGGACGAGGGCATTCCCTGG
ACGCGCATTGAGTTTGCTGATAACGTCAACGTCTTGTCACTGCTTGAAGGCCGTTTCGGTGTTTTGTCGTTGCTGAACGAAGAGTGTATGCGTCCTAAGG
GTAGTGACGCTGCGTTTGCCAACAAGCTGAAGGCGCACTACAGTGACAATGATCGCTTCGAGTGTCCGCGTTTTGCCCGCGATGCTTTCGTGATCAAGCA
CTACGCTGGTCCTGTGCAATATGACACAACTGGGTTCTTGATCAAGAACACAGATGCGTTGCAGAACGATTTGATCATGTTGATCAAGAAGTCGAAGGCA
CCATTCCTCAAGAAACTGTTCCCCGATGAGCATGTGGGTGATGCCATGACTGGTATCCCTGGTACCAACCCTGCTGCCGCTAGTGCCTCCCGTGGACGCC
CTGGTCTTAAGCGTAAGAACTCAATTGTCGCCGATACGGTGGGCACGCAGTTCAAAAGCCAGCTGAACGGTCTCATGGAGGATATCCGTCGCACAAATGT
GCACTACATTCGTTGCATCAAGCCCAACGGCAAGAAGAGCCCGCTGATCTTCAACAAGCTGCGCGTGACCGAGCAGCTTCAGTGCGCAGGTGTCGTGGAG
GCCGTCCGCATCAGTCGTATGGCGTACCCCAACCGT