Description :
From Genome Similarity Track
Location :
Scaffold_275:1803- 3680
Transcript NameFunction/comments
g14771.t1ETO65275.1 hypothetical protein F444_17402 [Phytophthora parasitica P1976
g14772.t1hypothetical protein

Sequence
1877 bases(100 bases per row)
CAATCCGATCTTGAGAGCTCTCGGTCGAGCGGCCGCTGCAGCTGCTGCCGCCCTCGCCTCTTGAAGATTGGCAGTCGCAGTGGAGTGGGCCGCGTCTGCC
GCCTCTTTGGCCGCTCGACGGGCCAAATTCGTTTGGTGGCGCTTGCCCTGCGTGTGCGCCAAGTAGTTGCCCTCGTTGTTGTGCAGCGTGAGGCAGAGCT
TGCACTCGTACGAGCCCAGGTGGTTCTTCATGAAGTACGGGTCCTTGGCCAGGTCCACCGTCTCCAGCGCCAGCTTACGCAGCCGCTCGCGGCGGTCCAC
ATTGCTCTGCGACTCCGATGCCACGCCTCCCGAGCCAGGCTTGGACCCCACGCGGTTCTGGAAGTCCATGGCGATTCGCTTTTGGCCAATTATTAGGAGG
GCGGGAAGGCGGTATGAGAGGCACTGACAAAAAGAATACATTTAATTGGTATTTTATGGCGAAAATGTTAAAGCTCATCGTGTAGTTCCAACATGCTGCA
AAAATGGCTTACTACTACGTAGTACATCACATCTCTCAACGCTCACTACAACAATAAAAGAAACCAGGTAATGTTCATTCACTGCCTACTTCCGAGTGGA
AATTACAAACCTCTTTACCCAGATAGTGTTGACTCTCGCTACGATAGCACAAGCAGAAGCCAATGTGACGTCTACGGGTATTCAATGTGGCGCGCGTTGT
AGTACTTGATGTAGCTCTTGAGAATCGGCCAGTTCTTGTGGCCGATCAGCGGATACACACCCAAAAGATTTAATTCTTCTTGCAGCTTGATTGGTTTCTT
TCCCGCCAGATACCAGAACGGAAATTGAGCCTTAGCCTTAGCCTTTCGAGCTGCCGCCGCAGCTTTTGTCGCAATTTCCTTCCACCCCCTCTCTTCGTTG
CTGGGTGAGTCGTCATCGTTCGCTTCGGCCGTCTTGTGGGTTCGTAACAACCTCTTTCCGCTTGCGCTGTCCTTCAGTGACTCAATAGTAGATACCGGGT
CTGCATTGACCACCTTGGAATTCGATGCTGCAGACACAGCGTTGGCGCTTGCAAGGAGGCCGAAGATTGATACGATTAGGAGATGCAGACGCATTGGGAC
GCTTGAGCACTGAAACGCAAATTGAGGAATGCGCTGGCAATGCAAGCGCATTCTGCAAGTTGCATCAAAAGAAAAAAAATGGTGAAGCTGAGAGCCTGTT
CACCATCTGGATAGACATCGCATCTTTGTAGAATTAACGGTGTTATACCATGTATAGTACTATAATAGTAGTGACTTGGCGATAGTGAGTTGCGAGGTTG
CAAAATCACTTCAACGTACTAAAGCGATACCTCAGTACAAGTTCGGAATTAAAAGAAGTCTCTCTGTACCACGTAATTTGGATCCCAAATCACTTGAAAT
TTGTATGAGGAGGTTTTGACCAGATAGAGTTGATTAAAGTAGTCTGGATCGGCCGTACTATGGGAAAACAAGCGCTGAATAATAAAGCTGTGATTAATCA
AGTACACACGCCCCTCTCAGTAAGCGCAGTAAGGGTCACTGAAGCCATTTTAAAGGTGTTAGAGATAATGAGTTCGTACGTAGTGGTAGTAATTATGTCT
CGGCGATCAGATATTACGGGGCATATACATGTAAGTTACCTGTGCTACCACAATGATCACGACACGTTGAACAGATCCAAAGATCCCCATACGGATTTTC
GTAACGGGAACATTGACTTACCTCACGTTTGTGTGATCCACACACACTGTACCGAATTTCCTATACACCTCACGTGTAGAAACGTGAGGTAAGTCAATTT
AGACTACAGACAATCCTCTCCTTTGTGATAGCGTCGGGAACCACCACATTATCACTCGCTGGAGTTATTACAAGGCA