Description :
From Genome Similarity Track
Location :
contig_30:180298- 200816
Transcript NameFunction/comments
g5303.t1trafficking protein particle complex subunit 2-like protein
g5304.t1hypothetical protein PHYSODRAFT_566404
g5305.t1notchless family protein
g5306.t1hypothetical protein PHYSODRAFT_307611
g5307.t1mitochondrial-processing peptidase subunit alpha, putative

Sequence
20518 bases(100 bases per row)
AATTCTGCTTGTGTGACCTGTAGCTCCATCGAATGAAGCCTTTTCGCCTCCCGAGCTGCTCGAATGTGCAGATTCTCTTCCAATTCGCACTCGACTTCTA
GTTGGGCCATACGAACTTGCTTGTAGTACTCAGCTTCGAGCGCTCGCCGACGAGTCTTAGAGACAAAACCCTCTCGCTGCTCAAATTTAACGAGCGGCAC
AATACGAACTTGCCCTGCAGCGCTATGTGAAGAATACATTCTGGCCACGTTGGTGGGTGCACTCGCACTGGGCTGGTTGTCGGAATCTTCGTCTTCTGGC
AAACTTAATGGATCGAGTTTGATTTTCTTGGTCAAGCCTGCAGCACCGTTGGCAGGGAGTAAGGGCACTGAGGAAACTCTTAGCTTCCCAGTAACAATCG
GTGAGGGAACGATCGTTGTCTCTATCTTGGCACGAAGACGCTCAATTTCCGTATGACATTCCTCAATTTCCACCTCCAGCTCCTGGAAGCGAAGAAATTT
GCTACCACGCGCGTGAGTAAGCCCCATGAAGTACCCACTCGGTACCTTGACCTTTCTTACCTGCTGTACTTAAGCCGGTCTAACTCTTGCCTCCGCTCCT
CAGCAAGAGCTTCAGCTGTCACAGCCTATCTAACCAACGAGATGACAGTAGCCCACAGTGCGTCAGAAGCAGCTTATTAACCACCGCAAATGTTTAGATA
CGCCACGCTACCATACCCGTTGCATGCATTCGGATACAAGACGGTCAATTAGCTCCTGCTTGCGGGTTTTAGTGGTCTTTGCTTCCTGTGGTGACCTCAG
GATCGCAAAGGCAGCGTGCAGCTACTCGCACACATATCGTAAGCCAACATTTACAGTAAACAATGGCACCAAGACAAACGCCTTACGTCTTTGTCTTTCT
TTCGCAGTGTTTCCTGCAGCCTCCGAGTTCCCGTCTTCAACTGTAGAATTAATGCATCCTTTCCAAATACAATCACATACATCAGCCCAGCCTGCCTGAA
CGCCACATTCCTCAACACGAGGCGCCACCTTCTCTCCCAGCTGCCTTTTCACCAGCACGAGCTCCTGCTTGGTGTTTTCCCATTCACGCCATCCATCGTC
CAGCTACCAAACAAATAAGTCAAATTCCACCATATTTCCGTGCAAAGTACATTTTTCTCCACCTCGAGGTGCTGGTAGGGCGTCACCTGGGGTTGGCTAG
CGCTTCCCCCACGCCGACTCATTAACCGCCTCTCCATGGTGACGTACTTGGAATGCAACTTACGTCGTTTCGTGCACCAGGAAATAAAAAAGTGTAGCCA
TGTTTAAAAGCATAGAAACCCGAAACGTCGCGATCTGCCTGTGAGATACTCGACCACATATCGATATCCTATCTCCTGTAGCATGGGGGAGGCACCGAGC
TGGCAGCACATGTGGGGAGCCAAGGTCAAGATGCCCTGCGATATGGAGGACGACGTGCTTGAAGACGCCATCAAGCACGTCACCTCGCGGCTGACCAAGT
ACGACACCGAGGAATGGGAGAAGAACGGTTTGGCGGTGAGGCAGCATCGCTTTGTGTCAATGTGTTGGTGCTTATACTGATGTATTGCTACTGCCAGGTG
TGTGAGGAGATCAAGGCGCACCTAGACGAAGCGTGGGACCCGCACTGGGTGGTGTGCATCGGCCGGAATTTCGGCTCGTTCGTCACGCACGTCACGAGAA
ACTTTGTCTTTTTCTACTACAACGAGAAAGCCGTGATGATCTACAAAGCAGGATGACTGTAGAGTACGGCGAGGACCAACGCAACATCCAGACACGTATA
GTTTGCTGCATTTGAGCGCTTGGTGTCATTATGCGCGAGTTGGCCACAAAACTGTCTGTGTAGGCAATCTAGTAGCTCCATTCATATGTGACGACGAAGC
TGGGGCTACAACGCTTGACACCAAGACTGCACACTGCCGGTAGTAAGAATTGAATCTATCGATACCTCAATGTGAAGCTCGAATTCAAAAGCTCTTCAAC
TAGTGCATGAAGTCACTTCAACTCATGCGCAGTCTGTGATTGGCTGAACGCCCAACAATTCGACCAATCGAAATGCAACGTCTGCAGCCCAACAGTTTTT
GACACAGAAAGCCATTCAAGCAGTCATGGCAACGCACGTCGCCAAGAAGATGAAGCTGGAGCACGAGGCCATCAGCTCCAGCGCCGACGCGAACGCGGCC
ATGAAATCGGAGGACCCAAGCGCCAGTGGCGATGAGGAGGACGAGAACGGCACGTCGGCCATCGCCCAGTTCCAGAGCGAAGACGTGAGCGCAACAGTTG
ACACATTTTACAAAAGCCCTGAGTCTCTAATTGGGTTGCGTTTTGTGCATTGAATAGGGCACCAATGTGGGTCCGCAACTGGAGATACCCACTAGCTCCA
ACGTGCGTCAGATGGAGGAGCTGGTGAATGAGCTGCTGCAGAACGGCAAGAACCGCGTGCCGTACTCGCTGTTCATTGGCGAGACGGAGGTGACGACATC
GCTTAAGGCGACGGTGGAGGAGCTGGTGAGTGGTTGCTGATGTTTTGCACTTTTTGAAACAGGTTGCTGACTGTTTAGTGTGCTGTTTTGGTGGTAGAAA
TTGTCGACGGAGACGGCGCTGACCATCACGTTCCAGCCGCTGGCGGCGTTCCGTGTGCGTCCGGTGACTCGTTGCAGTGACACACTGCAGGGACACTCGG
AGGCCATTTTGCACGTGAGTTTCAGCCCCGACGGAAAGAGACTCGCGAGCGGAGGAGGCGACGCTACCGTTCGCTTCTGGGACACGAACACTTGCATGCC
CAAGCACACGGGTCGGGGCCACAAGAACCATGTGCTGTGTACGGCTTGGTCGCCCGATGGCGCGCGTTTTGCGTCGGCAGACCGCAACGGTGAGATTCGT
CTGTGGGACCCGTTGACAGGCAAGCAGATCGGCCAGCCCATGAAGGGCCACAAGCAGTGGGTGAACTCGCTGACGTGGGAGCCCATGCACCGCAATGCCA
CATGCGAGCGCTTTGCGAGCTCTTCCAAGGACGGATCGATCAAGGTGTGGAACGCTCGCACTGGGCGATCCATCGCCTCGCTGTCGGGCCACACGGACTC
GGTGGAGTGCATTAAGTGGGGCGGTGAAGGCCTGCTGTACAGTGCGTCGCGTGACCGTACCATCAAGGTGTGGTCGATGGAGGGCGAGCACGTGGGCAAA
CTCGTGCGCACGCTGGTCGGACATGGTCACCGTATCAACACGCTGGCGCTGAATGTGGACTACGTTTGCCGGTCGGGACCGTTTGGCCACAATACCAAGA
GCTTCGCGTCGCGTGAGGAGATGCAGGAGGCGGCGCTGAAGCGGTACCAGGAGGTGCGAAAGGGTCAGCCGGAGCGCTTGGTGTCCGGCTCGGACGACTT
CACGCTGTTCTTGTGGGAGCCCGCGGAGAACAAGAAGCCGCTGGCGCGTCTCACGGGCCACCAACAGCCCGTGAACCACCTGAGCTTCTCGCCGGACGGA
CGGTATTTCGCGAGCGCGAGTTTTGACAAGAAGGTGAAGATCTGGAATGGCCAGACGGGCAAATTCATTGCCACGCTGACCGGCCACGTCGGTGCAGTGT
ACCAGGTGTGCTGGTCCAGCGACGCGCGCCTGATCGTGACGGCCAGCAAAGACTCGACCGTGAAGGTGTGGGAGCTCAGTGCCCCGAAGAACGCCAAGAC
GACGCTGTCGGGCCACGCCGATGAGGTGTACGCGCTGGACTGGAGCCCCAACGGCGACATGGTGGCGTCGGGCAGCAAGGATCGCACGATCAAGATGTAC
GTGCACTGCTTCCCTATTGTGGACGTACTTGGCCAGTCACTAATTCTCCGTTTTTTGTGTGTCATCTCGCAGCTGGAAGCACTAAGCTCGAATTTGAATA
GACCTCATTTTGCCTCTCTCCAAGCGAAAGTTTAACGTTAGCCACTTCAAAGGACTACACCTTGATTCAAGGGCTTCCAACCGCAAAATCGAAAATATAT
TTCACACCTATTTTTTATATTTCCGTAAATACATTTCGTAAATAAATGGGAGAGGCGGGATTTCCCGCCAACTACGCCGCTCACTTCGGCTTTAGCGCGC
GGCCAGCACCGACCAACTCTCTTTGCTGCCGTGCATCTGTTATCTCCAGCATGAAGCGCGGCCGCGACGAGAGCTCCATGGAGGACTGCGACGCCCTGGG
AATGACGCCCCCTCCGTCGTCGCTTTGGGCCTCCATGTCGCCCTGGAAGCCGCCACACGCGTCCGCAAAGCGCTGCAGAGACCGCTCCGTGCCCGTCGGT
GCGTGCTGAAACTCGGTGTTTCAACTTGAAAAATGACTAATTTAACATGCTTGTCCTAAACTAAAGACGCGATGAGCCGGATGATGTCGGCCGCCGTCAC
GAACGCGCGCATCAAGCGACACAGCTCCATCGGCAAGTTGTTCGCGCGCTCGGAGACACCGCTGGCCTGCTGCGCCGTGTGCGAGAGCTCCGGACGCCCA
GCCAAGCACCAGCTGCAGCCCAGCCAGACGCACACGTGCTCGCACTGCGAGAGGAGCATGGGCGACTGCTGCCGGCGCGAATGCGACGCGTGCTGCAACG
TCTTCTGCTCGCTGTGCTCGACGCTCAATTGCGACGCGCAACTGGACCGCGTCTTCTGTTTGTCGTGCAGTCTGGAGCAGTCCAGGGTGTAGAGCCTGGG
AGACTACGAAGCTGAGTTTGCAGCTTGCTGTTGTGCAAGAAGGTTTTTCTAATTAGTAATTCTAAAGTGCATGTTTCTAGTTAATTTTTGTATTTAGCAG
CAGAAGGTGAGGTGGTTGTGAATCTAACTGAACATGCCAATGCCAGGTTGGTCGTAGAGGAAGCTGTGCACGATTTCGTAGGAAACCGCGGGCTGATCGT
GAGGAACCATCTACACATATACGAGAGCAGGTTAGTTGGTGGGAGATGCAGGACATGGGGCTGGGTGAACGTACGTGGCCTGCGTTGTAGACTTTCATGA
AGCTAAGTCCGTGCGAGGTGCGGATGCGGCCGATGCGTCGTCCGTCCAAGTTTTGCTCGGTGGAGGTGGTGGAGGAGAACTCTGCTTGGTGTTTCCAGAC
GAGGTCGCGCGTCCACGAATCCTGCGTCATCCAGTTGACGACGGTGTCGGCATCCCCACCGTAGACAAGCACACGAACGCCCTGTTCAAGCGCCCGAGCG
ACGTTCGACTCGCTCTCCTCAAGTCTGTCCATCGGTGCCAATTGCTGAACCGCTCCGAGCGAACACAACTTCCACTCGTGTGGGATTTCGTCGAAGTAAG
CACGTACACGTGGGCTGTTGACGAGGTTTTGGAGACGTTCGAATCGGTAGCACAGCTGAAGAGGGTCGTCCAGGTGGCAATCACGACGCATGTCGTACAC
GTTTCGTCCACGCTCCCAAATTGAAGAGGAAACAACTACACCAAAGTCAGAAAGTATCTGCAGTGCCTCCCCGCAATCAGGGCCAACGCGATCATCAACG
GAATGGCGCAAGTTATTTCCTTGATTTTCTTGTGATTGGCTCCTGCAATTCGCAATAGACACCTTGAAGCGATCGACAGCGTCCTGAAGTGTTTCCTCGT
TTGACCCAAGAAAATTGTAGCCGTAGTCGTTAGATTTCAAGAAAGTAATCGCTGACTCGACCCAGGCACTTGTCGACACAACACCGTTGCCGATTCCAAT
TCCTTTCAGCGTAGGAAGTGAACCGTCATTCTCGAGCACTCTCACCGCCAAGTCCGGAACGTAGTGTCCTGCATAGCTCTCTCCGAAAATGTAGAAGTCG
TTGGCTTTGAGCTCTTGGTGCTGTTGATAAAATTGGTGAAGAAACTCGAGCATGTCTTCTGTAGCCCCACCAAAAGACCAAGGCTGCTTGATTCCATTCG
TCCCACCGCTGTACCCTGTGCCCTTGGGCTGGTCGAGGTAGATAACGTGCGCGAGTCCAGTCCACGAGTACGGATTGAACGAAATCGTGTCTGCCTCGTC
GTCGAATGAACAAGGGCCATTTTCAAACAGTAACGCGACCAAGCCAGAGCATCCAGGCCCGCCCGAGAGCCATAGAATCACAGGAATGTCGAATCCATTG
GAGGACGATTCGTAGAACACGTAATAGAGACCATTGAGGGTTCCGGTCTCCTTGGCGATGTTTTCCCCACACAACGACACGGATGACGGGTACTCGTTAG
CAAGGTCGTTCGCTTGGGCGAACAAGTGCTCACCATCTGAGAACACACAACACCGCGCTATCAATGCTAGCACGAGCAACCACCAAGCGTGGAGACGCAT
CGCTGATAGAGAAATGTAGACGCGAGGATCGAACCTGACGAGTCACATGCGACCTTTGCTGAAGATTGCGACTAGATGAACGGTTGGTGTTCTGTAGTTC
CACTTACCACTACGACACCAACGAAACTAACATCATCAGCGTCCTTTTTCCAAACGGACTCACACATTGGCACAGCAACGGTTAGAAGCCTTCTCCAAGG
TAACAGCCGTAGCTCGTAGCAACTTCTATGCTTTCATTCAATCTATCGGTCTTCATTTTTCAGCTTCAAGCACAAGTACTCCGCCAGACTCCGTTCGCTA
CAGACCACGTGACGCTATGCTGTTCAAATCAAAAGTAGATCGACTCCATGATGGAGCTGAGAGGGTCGTAAGCGGGGATGAAAACCTCTTCAGCAGGTAA
AACATCTTCGAGGTCTTCTAGCTGCACTTTCTCAGGGAGCAGGATCCGGGCCTTCAGGAAGGAGTTCCGTGGTTCTTCCGCGGTAAGCGTCGTGTAAGTT
GAGAACGGGAGTTGCTTGGGTGGTGCCTGGTAGCAAATACACACATATTACTTTCAGAAGTGCCAGCAAACAATACCCGAACGAAATGCACCACCTCGAG
TCCGGGCAGCTCTGAACCAGCATTCATGGCGCCGTGTGTCGATTTCGTAGTTCGTGGCATGTTTCCAGGAGGTGAAGCTGCACCGAGATGTGGCGCCTCA
CCAACAGCGCACTCTTCGTTTGCAGTCACCGGTGTTTTGTCCTGCGACCAGGTCCCGTTGAAGCAGAATCGACCCAACGAGCCCATCGCACTCTTCTGCT
GCTTGTTAGTAGGTGGTGTTCGCTTCGGTTTTTTCGTTGCTGGTCGACTTCCTCTCCTTCATACGGACGCTTGCCTCTTGGCTGACTCTTGTTCTTGCGA
CCAGCAGCCTTCCCTCTTTTGCTGCGGGCAGTGCCCACCTTGGATTCACCAGCGACTGCTCTTTGCTTCTTGCTTGCTGTTGCTGTGTCCTTCACCCGCC
TCGACGGCACTATAGCCTCATTTTGAGCCTTAAATACGGGCGGATGACGCGGAGGCTTCGCAGTAACAGCCTCTGTAGGCTGGTGGTGCTTGACTTGCTG
AAGGAAGCTGTCCATGCGCTGTTGCTTGGCGTTCGTCTGGTGACTTGTAAGCGTCTTAATGTACCGAAGGATGCTACTATCTCCCGAGCTCTCATTAGGA
GCCACTTCCTGCCCACTCGGAGCTTCAAAGGTGCGCTGCACCATCGCGTTCTGCTGGCAACTCGATGCGGAAGAAATGCAGAGTGATGGTATCAACTTCA
ACTTGCAGTTTCTTTTAGTAAAATGTAAGAGGTCGCGCTAACTTATCTGTTGAACCACCGCTTCTTCTTAGACTTGTGTCGGCTGTAGACCACTGCGGCT
CGGCGACCCCGTCGGGAAATTGTGAGTGACGTAAGCGCCGAGCTGGGCGCCGCGGAGCTTGGAGGCTTCCAGGAATCCAGCAGGGAATAGCGCCGCTCGG
AGTTCATGGCACTCGTTCCACTCTGCCGACTCAAGTAGGTTGTCGCTTCCGACGGGACCTCCCCTCCGGCTGGAGGCTGCCGGCGAGTTGATGGCGCTTG
CGAGTAGGTGGCGTTGATACTGCTCATGGGGATGTTATTACCTGCAGCAGCAGCAGCCAGTCTGTTGACTGGCTTCGCGTCGACGTCGTCGGGATTCAAA
GGCACACTTCCGCGACGGGGACGTGGCCGGGTAGCGAAGATGTCTTCGTCGTCTTCCTTCTCGTCATACTGGGCCGCTTTCTTCGAGTGGTACTGAGAGT
CAATCGGTTCGTATTGAGCTCCTAGCGTCGAGTAGCGTACCGATGTGGGCGAAGGTAATGGCGAATCGAGTGCCGCTTCTCCCCTGTATCGGAAGCTTCG
CGGCGCAACAGCATCCCCCACCTCGATGGCTCCAGCTGTGAAGTTGATGCTCTTTGGAGGGACCTGGATAAACGTGCCATCGATGTCGATTTCGCGGTCG
TCAGGGATGCCTTTGATGTCGACACGGATAGAAGGCTCACGCTCGCCGTCAACATCAAAACTTCGAGTGCTGTCAACACCTGGCGCTGCTCTTGCTCCAT
CCACGTCGAAACTTTGCGTGCTTAAGATGTCCGGGTCCGCAGAAACTACGTTAGCTGCCACTGGTGACTTCGTTTCCGATTGCCCAGTTTTAATTGAGCC
ACGGATGATTGAAGGTCTGCTTTCCAGTGTGAAGTTGTGCCAACGACCCATGAAGCTGCGTGAAATCTGCTTCAAGTGCGTTTCTTTTGGCTCTTCAGCA
TGAATGATGCGCAGCACACGATTCACATTGGAAAAGAGTGAGGCCTCGATCTGCTCCTTGTTTTCAACAATCCTTCCAGGAACGCTAGCGTTTGAGGGTA
GTATTTGAGGTCTTTCAGCCAGAACTCTGGTTCATCCTTCGCCTCGCTTTCTGTAAGTGCAGTGTTGCGTGCCTCCAGTACACGACGAAGAACCTTCAGC
AGGGACGGAATATCTGGGTGCTGCATGGTGATTCGACAAATGAGCAGCTCCATAAAGTCTTTTGAAACGATCTCTGGAAACTGCACCAACCGCCGGGCAA
CGCGTAGAATGCAGCGGTACGGAAAGCTTGTGATCAAGTTCTGGTTACAATAACGCACAAGCTTCACGATCTGCTCTGGCATGCGATTGTTGGCAATACT
CTCATCAATATCGAGGGATGCCCGCAAGATATGTGTCATAGCCATGGTATACTTGTCGATCTGATCCGCCGTTTTCTTGAGATTGTCGGGATTATGAAGA
TCAAAGCGCATTAAAAGGTCGAGCTCAGTTCTCCACGTTTGAAAAAGCAACTCCAAATTATAGGCTGGGTTCGTTAGCTTTTCTGGATCCGGCCGGGACA
AAAAGCGATCGATGTAGAGACCAGCCACAAAATTCTTTGGGAACGAGATGCAGTCAGTTTCGTCGTCCAGCAGAACGGAGTCTCGTTTTGCTACAGACCG
CTCGAGCCGATTCCGGCAAATAATGGTGTCAAGCTTCTTGCGAACTTCTGTACGTCTGTGAGAGTTCCAGATCAAGTCGCTCTTTTCGTGGTTATCATCG
AAGAATCGTGACGCTTGGTTTGGGTCCAAGTGAATTTGGTACACAATTGGGTACGGTAGGAATCGGCAAAGTCCACTGTACATCTTCTCTCGCAGCTCCA
AGTCTTTCATCAGCAACGCATATAGAACTTCAAACGCTGGCGCTCGCAGCGCTTCTGCTCGAAGAAAGTGTTCGTGCAGAACGTGCTGTCTGGATTGAAG
AGCAATGCCCAATATCTCTACCCAGAGCCCGCTTATTTGTACGTACTCAGCAATGACTAGGCACGTATCACACAGCTCCGCCAAGCAGGAGAGCGCATAG
AATGCTTGCTCATATCCAAGATGGTCCGTGATTACCTGAAGGCACCACGTGAACTGGCAAAAAGGTGCCAGCATTCGCTCTAAGTTGCACTCGAACCCGC
AGATTTTGTTTAAGATCAGCAGTGCTAGTTCTTGGCGGTTTAAATAGTCCACGTTTCCAAACTCAGCTTCCATTCCTGGGGGTACATCGTCAGTTTGAGC
CTTCGCTTTAAATCCATTACGTTGACAACGATCGCCGAGATGATATCGATACACCCTTCGATTTGTCATCGCCATCGAATGGCAACAGATATCTGCCTAG
CGTTGCCACCGATATTGAAGCGTTAACAGGATCTACATCATCAATATGCTGCTCAAGACACTCTACGATTGCGGGCCGAAAAGCTGGCAAATCGCAAAGA
AAGCTTAAGCAATCCAAAGCAGGAAGCGTGTCCGAATAAATACCAAGTTTAGGGTCTCTGTTCTCGTTCAAAAACAAGAACAACGCCGACACAAAATCAA
CGGCTGTGGTTGGGTACAGCATGTCCTCAGTAATTGCTTGAGGGTCCTCCTCCGCCTTCTCCAGTAATATCAGCAGGTAGATTCCTCCAATAAATGGCTC
TGTACTTAGGCAATCATACATGTGGTTTGCAGCGGTTTCCAGAAACGACACTCCATCACCATTGGGGTCGGTACAAAATTCCTCCGTAAGTTGTGAAAGT
TCAGCTCTTGTGCTTTCGTTCCAAATACACGTTGGCTCGCGTATATCTGACAACAGAATGGTACAAAAGTCATGCCCTTTGGGCTTTTCAAGACAATCTA
AGAAATCCATTGGAAGCAGATTTGCCAAGGCATCAAGCCCCGCTGATCGTCTATTTCCATCCGGACCCAGAGCAAGAGATCGGAGTGCGCCAAAGGCACT
CTCTAGCATTTCACGCTCTTGTTTCTCCAAAGCGGTGGTAGATCCCTGTGACGTGTCAATTCCTGATGAACTTTCAGCCGATGCCAAAATCAAATACAGA
CCCTTCCAAAATACCCGTGTGGATGTCATGATTTGCTCCTGAAGCTCGTGGCTCCTGCACAGTGATGACGCAATTTCAAACGACATCTTCTGGATATGCC
ACGGCTGGATGTTTTCAAATGAAAGAATGACATCATCTAGCAGAGAATAAACGCGATGGGCGTACTTGGACCTGCATGCTCCATTTTGAGACGTGTACTC
CGTCGCGGTAAAAAACGAGTTGTTGTCATCGTCCCCGAAAGTGCTAAAATCAAATACCTTCGACGGTGGCGCCCCGTTGCTTGTATTAGTGCCTCCTCCT
TCCAAAAGCGAGTCCACGCCTTCTTCGGAAGCAAGAAGCAGTTGAAAGAATTGAGACATGCTTTCTTTTGCAGCCACGTCGCGCCCATATGCACAGCTTT
CGACTAAATTGAGAATAGTGTCCCAGCTGCCATCGACTTTTACCAATAGCGGACCATTTTGTGGCGCAACAGAGAGCAATCGCCGCAGCACGCTCATCGC
CAAACTACGAAATTTGGACTCCCCCGACGATCGAGTCGATAGAACGCGAACGAGTAGGTCCAGCGTCGAAGACTCGTATGAAAAAAACTGGTATCCAAAC
TTGTCCAGCAATTGCAATTGTGCCTTCAAAACGCGCTCTATGACTTCGTCCGATGTACGCCCACCATCAGCTACGTCCCTGCGCTCAAGCAAACCATTTA
GTGAATCGAACGCGTTGCGCACTGTCGTTACCTCGACCTCTTGTTGACACAGTTCACGAAAACGCTGACGCAAATCCGACGACGCGTACGTCACATCTTC
ACTCCACCCAAACACCTTATATGCATCCGAGTGATCTGCATCCTGATCAATCCCATCCGCTTGATGGCGTACCAAGTACCGCCACTTCTCCTCGATACTC
TTCATGAGGAATACAGGGTCTTCAACCTCCTCTTCAGTATCAGAATTTGACTGATTAAAAGTTGAAAGATAGAACCCACTGCAGTACACGTCTCCAGACA
ACTCCAAGAAGGAAATTGGCGGATTGGAGTGTAGCTGTACCTAACAGCAACACTTTTTCTGAGATCCTCTTTGAAGTCTCGCAGGTGTTCAGCCAGCATC
TCTTGTAAATGCACTCGCATCGTAGATGACCACATTACGCGTTTGTCTTTCTTACGACCAATAAAAACATCGGCAAAGTGTTCAGGTGGCTCTGAATCCA
GAATATTGATGAGGGACTCTGGAAGCATGTCCGTCAATTGACTCTGTCCTGTGTGCAGCTCCGATGATCGCTGAGTACGATGAACTCTTTTAAGAAATGC
TGCTTCTGGAACGAACGCAGGCACTTTGTCCGCTTCTCTGGCAATAGCGACCGTAGACAATATAAAGTAGAAGGTTCCATACTGGTGTAGATCTTGCAAC
TCCCCATCACTCAGTGACATCAGCATTTCACACACGTAACGCCGCACGCTCGAGTCATTTACAAGCAGCAGCTGGATCATAAAGGCCAACGATGACGCAT
TAGCTACGACGGTATTCACTAAGGGTGGTGGCCACAAATTTTTGTTTCCAATCGACACTGTGTGCTGATCTTTGATCATAAAGTTCCTTAGCGTCTTCAA
AGCATACGCAGCACATTTCGGATCCATGGGTTCATCAGTCAGCTCCATCCAGCGCAGTTCTGGGTATTCAAACATCGACTTCCACGTATGTTCGTCGCCA
TCTGAACCCGTGTGTGTCGAACAGCTACACACGTATAGGGCATCAATTTGGCGGTGCCGAATGAGAGGATCAGCTTCCAGATATTCCTTCAGCTCGTTCG
CCGAGTATGGGCCATTCACCTCACTGTTTCCCTCAGCATCCCCCACTGCCTTAAGCTTTATGCTCCATTTGAGCGCAAACCTGGATTCGTCGTACAGGGA
AAGCTCTGCAATCGGAACTGAGGAGGTTGCGTCAGCTCCCGACATGACCAGTGAGTCCATCATCGGTATATCACTACGATCGTCCGTTACTTCACTCCCT
ATTGGTGCAGTCCGACGTCTGTGAGACAGCATCGACATGTACAGTAACACTTGAATGTAATTTTTAGTACATAACTCAGCGCAAGCCTCTCCAGACAGGC
TCAATCCAGATATTAATTCGACGACATCTTGAATTTCACTCGCAAGGTATGAGTTCCGCAGAAGTTCGATGAGAAATCGAGCTCGATGTTTTGTGATAGG
TCGAGCTTCGGGGAACACATGGGCTAACTCGATCAATATTTTCAACATCGAGTGGCCGTGTTGCTCGCTTCCAGTTCCTCCAGTAAAATGCGGAAATCCG
TTGCTTCCACTTGCAGACCAATCGTTAGTTCCAGATAGCGGAATATTGTTCAGATGAAGATGTTCCAGCCAACACTGATAAACCTCGCTGAAAAACTTTG
CCGGGTCCTTCGCAATATCCATACTGGCGAAGAAAAGGCTACTCGAGTTTTTCAACTTTCCACGATGTGTTCCTGATTCCATCGATCGAACAATTTTGCG
ACTTCTGCAACTGCAGAGATCCATCGTTTATTCTTTCTGTGATAACACGGAGGTAAAATCGATCAACCTGAAGCTCTTTGGAAATGCTTTCGTACCTCAC
AGAAAATTGTGCGTGATTCCACTTGGGCTCTCTACTTCCTTTACGAGAAGCAACCAAGGATAGTGCAGCGGCTTGGTTAGCTTTGAACTGATCAAATTCG
TCGATCTCCGATTTGAGAGCAGCCTTCAGCTCACCTCGTGTTAACTCGTTCCAAATTAAGTCGGGGAGAAAAAAATCTTTGCCGACCATACTTGACAGGA
GCGCCATGTCGTGGATGATTCGCCAGGATAGTTCGTACGGGAAGGTCCTCCTTGACTCTCGCTTCTTTTACTGACCCACTTGCAAAGAGTGTCCCGATTT
GAAGTTGCATCCGACGGATAAACCACTCCGAGCCGTCAACTTGATCCTGAAGCTGGTGTTTGCTCTTCCGCCTGGACTCTGTTTGCCGAGCTCGCTGTTT
CTTTAGCAATTTCCGTACCATTGGGCTTGAGATCATACGAATGAAACCATGGGGAAGGATCTTCACCAGCATCTCATGAGAGGGTTTGTGGTGGGTAACC
CAGATGCTTGCGATGTACTGATACGTCTCCTTCGCATTATCCGAGGGGTGAAAAAAAGCCTTGCGCAGGTGTTTAATTGTTAGGCCGGAATCTAGCGCAA
CGTCACAAATGCGTCGCCTCATCTTATGATCACCGTGGTCGACGATCACCTTTAACACGCAAATCACTGCCGCTGCTAATCCTGCATTTACACTTTGAGA
TGCCAACTCCAGCAGCAAGGTATACTTTCCTGCAAGAGCTTTTACCAGAGCATCAAAATGATTATTATCAGTGCTGTGCCGCGAAACGACGAGCACATCC
AGCATCAGTTGCAGCATAACCAACGTGGAACTTGGATTTCGTTGTTCCAGGAGACCAGTCAGTAGCGAAATAAGCTTATTGTACTCAAATACTTGAAATC
GAATGTCCTTCTCAGCCGCCCGATGCGAATTTGATCGGGATTTATCAGCAACCAGCGAGTGAAGTGCATTCACGGCCCACACAGTTGCAATCGGGTCACC
AGAGACCAATACTTGAGCCAGCGTTGGAACTATTGTCACAGCACCGCCGTTCGACTGCTCCATTGTAAACCGATAGCATCCATCATTAATGCGGCAAAAC
GTTTCCAAGATAATACAAACTTCGTTCGCGCGAATTGGTGGCTTGCAGGAGTGTTCAAGCTGCACCGAAGCCATAATAAACAAAATGTTAGAGGTCTAAA
CAACAAAATACTACGCATAAGTGCAATTCAGGCCCACTTACCAAATTATTTACCCCACGAAGCAGGGACCCGAATGAAAGCTTTTCCAAACGACCGCGCA
TGGATTTCCCTGCAAAATCATTCGTCTCAACATTCATATTCAAGCTCTCGAGCGCAAACGTGATCCTGTTAGTCGCAGACGTGATACTCACGCCTTCCCC
ACCCATTGTTTCAATTTCTTTTTCCAGAAGTACGTGAGCAGGAATGTATAGTCCGTCATGGTTTAGATAGAGAAAGTTCTCCTGCTCGTCCTTTAACAGT
GCTCTGGGAGACATTCTCGGGTTTAGGTTGGGAAACTCGCGACTAAGCGACACATTAAAATTATCGACATAGCGATATCCGTCATACAGCGCTGCCAGAA
ATTTTTCAACATCGTATGGAACGTAAACCACGCGACTGCAATCCGAAAATTCCAACGCTACCATAGCCTGAGCGTCAGTGCTGTCTAATCCAGGGATTAC
AACCCGCCGCAAATTCTTGAGGTCGTACGTCTTTTTCGAGCAGTCAGTAAGCTCCTGAATTGTTCCATGTACGAAGCACAGCTTCTTTTTCCGCAGATGA
GTAGATCCATGTCGACCTGTTCGTCTTTGAACGTCAAAAACGTCACTCGATTCAAGAGCACATTGGTCAAGAGCCTTTTCAATGGATTGTTTCGGCAGCT
TGTCCCGAGTTTTGAATCGTAGATGGATGCCAATGACACCAGCTAAGGTCTTCATTTTCGTCACAATATCATTGCTTTGGTCGGAATAAATAAATTTTAG
CTTTTTCTTTGCGGTCAGTATGAACGCGTCTGGGATGCTCGCGGCCTGCGTTATTTCTTCGATGGTGCGGTATTCAAATTCATGAGTGTGTCGATTTAGA
ACCCGAACAGCGATTAGAGCGCGTGGTGTCAGATAAAAATTGGTCTTTTCTCGCTGTCCATCTGCTGCACCAATAAAGCCGCTGAACTGGCAGCAGTCTA
CGCTGTACACGCGTTTGAATTCCTCAAAGTTACCCACCAAATGACTCATCAGCTCCTGCAGAAAATTATTTCGACATCGGTAGCGGAGGCGTAAAAATAC
CGGGTCATCGTATTGATCAATGCCCATCTTCAGCGACCCGCACGCAGATTCGAGAAACTGCCGATACTGCCGCAGCAGTACTTCAGGATTCTGAACCACT
ACCATGCTAGGTGCAGTTCCATCATTACCACTTGATAGCGACTCTGACGACGAAAATGTGTTTCGGCTGGACGAATAGTTGTTTCGTCTAGACGAAAAAA
TGTTTGGATGACGAGAAAATGGTGCGACGGCTCCGCGTTGGCTGTTAGGCCCGAAATTCAACGTTTCTCCGAAACTGAGCGTTTGCCGAGGAACTTGCCC
GTCATTGGACCGCAATGGGGAACCCATATTACCAAAGTGCAAAAATGCTGGGGTTTTCGTCATCCGGCTCAAAATGCCGACGCACGCTTCCACTGTCGCC
AAGCCAGGAAAGCTGAAAAGAATTCGAAGTATCATTCGGTATTTCGTTGCTAGGTGTTGATACAGCGTTTCAGACAGTTTTCGCTGCTTTTCGATGTTTG
CCTTGACCAATAAAAGAATGAACTGGCACAGCTTCATTGTCGGTAGGTCGGATAAGAAAGACCTCGTCTACATAGCAAAGCAAACTCGTTAGAACACACA
TCGCTAAGGCCCAAACATTTTTCGACGTACATGAGTGTCTTCATCTAACAATGATAGAAGTGTCATGACGAAAAGACTATTTGATAGCAGGAGCTGCCGA
CACGGCAGCTTATGCGCCTTGGACTCCATCAACGGCTCAAGACCATGAACATCCAGTAGATAGCCACGGAGTTCTTGCTCACCAATATCTTCGATATCAT
GATCATGTACTCTTCTCGATGCTAGATTGAAAGCAAAAACAAATGAGTAAATTAAATGATACCTCGCACGACATGTGAATGCGGCGGTCACATGTACCTC
TGTCAGAATTTGCATGAACTCGTTGATCGCAGGCGGTGCAAGCATCAACCGATAGAGTGACTGGAGATACGTGATCACAAAATCCTGATTTGCTCCGTGA
CGTTTTACAATGTCATTGAGCTCACGTGCAAGCACATACAGCACCCTCTCGAACGGTTTGTTCGGCTGGGCAATGACACCAGAAGTCGGCGTATTTGCGT
TTAGCTCCGCCGCCAAAGAGTGCATCTCTTCGTCGAGACCTCGAGGAAGCTGGCGCTGAAAGCGCTCTGTCTTACGATGGCCATGTACAGACATTAACTG
CAGAATGGTTGCCTGGGCAACACGGAGCTCGCGATCCAATACGTTCACATTCGGCACAATGTTCGCGATCTTGTTGCCTTCCTGCAATATTATCTTTCGC
GGTATCATACGCACCCAGTCCGGAACCTCCATGACCTCCACGCCCACTTGGTAATTCCCTAGTGCATGACACGACGCCAAAAGTTCGCATACGATCTTCT
CGCGCTGGGCAGAATAGTATTTGCGCTTGATGCCATCCACGTACACGACTTCAAACGCCTGCAGCGTGTCCTGGTACATGATGAGGCTGTAAATGCGCGA
CAACGGGCGACTGGAGATCACCGTCGTGGCGTCTACGTATTCCGTAATATACTTTTCCGAGACGGACAGCGTCCGTGGGGCAGCGCTGGACTCGTTCGAC
TGCGACACTTTGAGCACTTGGTACTCGAACGAGACACTGGTGGTCGACGAATCTTTCCCGTCATCTTTGAGAGCAGCCTCGATGGTTTTCTTGCGGTACT
CGTTGATCTGCATACCGTAGGCCTTCATGACTCTGTCGATAGCCTGCGCCAGCTCTGTGCGTCTCGGCACAATAAACAAACTCGAGTTGTCCGAGTGGTT
GAGCGCGATGGCCTCATGGTCGTCGCAAATGAGGTCTATCGAGACCAAACTCGTGTACGGGATGTGGCTCATGAGGTCTCCCTCCGTGTCCTTCTGGTAG
ATGCCGTCCGGTCGCACCTCCACCACGCACGTGGACTGCACACCGCCCCTGTGGCACTTGAGGCTCTGGAACGCGTGCGTCTGCAACTCCAATGGCGGCG
GTTGTCTAGCGTCGGGCGCCTTGGCGTAGTGTTGGCTGCGCAGCCGCATGAGGCAGACCAGCACCTCCATGCGGAAGTGGCAGCGGAAGACCGTCTTCTT
GATGCGGTGGCGCGGCGTGTGGATGACCAGGTCCGTCTCGCCCTCCAGCACGTTGGCACCGTCCACGTCCTCGTACGGCCACGTATTGGTCACGTGCTGG
TTCTCTCGGTCCAGCGTCCAGAACGAGTACTCCCCAAGGCACAGCACACGCTCCTTGAGCACGAAGCTCCCGACCTTGTGCACCATGAAGCGCGCCACAA
CGCGCTTCATCTCCATTGTCGAAGGTTCTCCCCCGCGCTCTCTCGCTGTGAAATTGCCTTCTGCCGCCTCTGGATTCTTCGTACGCAGCTCGATCTTGCT
GGCCAAAACACTTAGTGACGGCAGAGAGCGTCGAAAGGTCGCGGATTCTGAAGTACAAGGGTTGTTCGTTGAAGTACGATGGTTGGAGCAACTTTGTGTG
GCGCAACTTAGCAACTACAACTTGCCTTTTTCGTGCTTGACTTGCTGTTGCGTACAGCTCTGCGGTCGATTTCCGTGCTGAAGGAGGTACCGACGAAAGA
GGTGCGCATTTCGATAGCAAAGGAACCCTAGACTGTGGCACGTAGAGTAACACTGATAGAGCCGGCTTCGGCACTGTAAATCAACTTCCCCAGAGATTGC
TTTAGCGCTGCGCGCAGCAACAATAGTTTTCCACGTGACAATGGACAAGCAAATTTGGACTGGCCGCAACAATGAAGCAACTTTGTGTACTAGCAGGAGC
GAGATCGTTTAGAGGCGTCGTGAACTTTGAAGGAACTCGCGTTGTGCTCTGTACTATCCGCTTGGGAATGGACGCCTGAGGGATCAGCACAATCATGCTC
TTAGACTTCGTCATACTTTCCACTATTTCTCCGTGTGTGGCGCCGCTTATATGATGTTTGATCGTGCTTGTAGATTTCCACCGCTCTTCAAAAATAAGCG
AGTGATCTCGTCGTCGTCTGGACTCGAACTGTATCCTTAAGTACGATACCCGTTTAAGTCCGTGTCTTATTGCCTTGAGATTGTATGGTTCTTACTAAAA
TCAAGTCTTTCGCGGGTTTTGGTGGTGAGCGGCTCGATGTGCGGCTCTGGGGCTCTGAGCACAGAAACGCGTTTGGCGCTGCACCCCCACCAAGTCCCTA
CCAAGATGCTCGCGTCGTCGTCGTCCAAGCTCGCGGCCCGCGCGTCGCGCTCGCTGTTCACCAAGGCCAGCGCCATGCCCAGCGTGGCCCTGAGCGAGGA
ATTCCCGGCCGTGCCCAAGACGCAGCCGCAGGCCACGGCCGCGCCCAAGCTGACGGCGTCCAAAGCCTCGTCGGGCTTGGCATTGGGCTCGGACGACCGC
GCGGCCCCGTGGCCACCATCGGCGTGCAGCTCAGCACCGGGTCACGCGACGAGAGCGAGGACACGGCCGGTGTGTCGCAGCTCTTCGCCAAGATGGCCTT
CCGTGCCACGGCGACCCGCTCGGACCTGCGTCTGTACCGCGATGTGGAGGCCATCGGCGGCGTCGTGCACGCTCAGGCCGGCCGTGACTTTGTGCGCTAC
AGCGTGAGCGTGCTGCCCGACCAGCTGGAGGCGGCCGCCGAGATCCTGGCCGAGACGACGTTGGCCCCCAAGTTCGCGCTCTACGACGTGGACGAGCAGA
AGAAGATCGTGCAGGCCGAAGTCGACCGGATCGGTGATGATGCCTCGGCGTCGCTGCTCGAGGGCCTGCACGCCGCCGCGTTCTACGAGGACCTGACGCT
GGGCCGCCCCGTGGCCGCCGCGGACAACCTCCAGGCGCTCAGCCCCGAGGCGCTCTGGGCGTTCCACGACAAGTACGTGAACACGGCCAACGCCGCCCTC
GTGGGAGCCGGCGTGAACCACAGCACGCTCACGGACCTGGCCAACGAGTACTTCGGCTCGTTCGCCAAGGGCGTCGAGGCCGCCAGCGCCACGGCCAAGT
ACGTGGGCGGTGAGACCCGCGTCAAGAAGGCAGCCAAATTCACGCACGTTGCTCTGGCGCTGCCGACCGTCGGCCGTGACTCTGCTGACTTTGGCGCCTC
GCAGGTGCTGCGCGCTCTGCTGAGCTTGCGACTCAACAACAAGAAGGCGTCCGCCTTCCTGTCCAGCTACAGCGACGCCGCGCTCGTGGGTCTGTCGGGT
TACGCCGTCCACTCGGAGGCCGGCGCCCTGGTGGACTCGTTCGCCGCTGAGCTCAAGAAGGCTGCGTCGGCTCCGGCTACTAAGGAGGAGCTGGCCGCTG
CCAAGACCACGGCTGCGCTCGAGGCTCTGGAGCAGTACAGCACCCAGACGGGTACCCTTGGCCGTGTGGGCCTCATCGCCACCACTGGCTTCGTGTCCCA
GTCGCCGTCGGCTCTCGTGGAGGGCGTGACCGCCGCCAAGCTGCAGGAGCTGGCCCAGAAGGCTCTGAAGGCCACGCCGTCTGTGGCGGCCATTGGCAAG
CTGTCGGCCGTTCCCCACGTGGACGCGGTGGCCAACAAGCTGCAGTAAACGACCAAGACGATCGATCAAGAGTGAGGTACATACATCAGTTTAGCACTCG
GAGCTTTTGGTGATGCACGTTGAAGTGACCTTGGCGTGAGTGCGGATGAACAGGACAAGACAGGAGCGTTGGATGTGGAAGCAGCGCAGAGACGCGGTAG
AAACCTCGAATTAGGAAGGGGGCATACAACGCTGGCGAGAGGAGAGGGCTGCTCAGACACACTCGTAACGCGAGGTGACCGATCGTGCGAATATCGCACT
AAATGCAAGAAAAAAGAACCAACTTTTTAACGACAAATGCTCGGTCAGCGGAAGCCGTTGCTGTGTTTCTGACAGTTCGATTCAATCGCGCAAGAGCTGG
CAAACGGCTGTAGCAGGA