Description :
From Genome Similarity Track
Location :
scaffold_13:18029- 20467
Transcript NameFunction/comments
g796.t1 conserved hypothetical protein
g797.t1 conserved hypothetical protein

Sequence
2438 bases(100 bases per row)
ATGGCACGCGGAGCAGTCGGACGCCCGAAGAAGGATGGAGACCACACGCGCAAGCCCCGCAAGAAAAAAGACAAGAACGCACCCAAGCGCGCGCTGTCCG
CCTTCATGTTCTTCAGCAACGACATCCGCGAGACGGTGAAGAAGGAGATGCCGGAGCTGCAGTTCCTCGAGATCTCGAGCGAGATCGGACGTCGCTGGAA
GAAGATCACGGCAGACGAGCGTCGGGTACGTGCTGGTGCAACGTAGCGCCTTGTACTGTGTGTTTTGATCGCTAACTGTGTCTTCTTGTTGCTTAACTAC
AGCCGTACGACGAGCTGGCCGCCGCTGACAAGCGGAGATACCAGGAGGAGAAGGAGGACTACGTCCCGGACCCGTCCTTCGAGTCCACCAAGGGTTCCCG
CAAGAAAAAAGACCCGAACGCCCCCAAGCGCGCGCTGTCCGCCTACTTCTTCTTCTGCAATGACGTCCGCCAGGAGGTGCGCGACGAGAATCCGAACAAG
AAGATCACGGAGATCGCCACGTTGCTGGCCGAGAGGTGGCGTGCGCTGCCTGAGAAGAAGCGCACCAAGTACAACAAGCAGCACGACGAGGCCAAGATCA
AGTACCAGCGCGAGATGGACATCTACAACTCGCGCGGCGCCGTTGAGCAGGAGGAAGAGGAGCACGAGGAGGAGGAGCACGACGATGACGACGACGACGA
CGACGACGACGAATAAGTTGGCAACTCGTCCGTCTGGCCTTGTCCGTCTAAAGGAGAAGGGACAAGTCGGCGAGCAGCACGGACGGTCAAGCGTCTGCAA
CTCTTTCTTTAGCTCGTAGTGGTAGCAGGACCCATCATGGGTCCCATGGGGTGTCCTCTTTTTATTCTTTCAAGCTTTTGGTAACGTTCGTGCGTTTTTC
CATTTCATCAATCATTTGCGCGTACGTGGCGCTCTCTCGGTAGTCGCGCTTCAACTCGGTTGTGCCTTTGCGTCGTAGAGTACCGCCGGAAACATGGAGG
TAGCGAGCCAAACGCGATGCCAGCTGACTTCAACTTTGGACAGAACGGAACGGAACACTTTGGAGCACCTGTTACGAACAGACAGCAACAGCAGCGCTAG
TCAAGTGAAAGTTTGACGAGTTAGTTGTCAAACACGAATCTAATGGTTAGACAGCACTTGTTTGTGAATCTTCGTCTATTGATGTAAGCGCAAGTTTTAG
CAGCTGGGCCTGAAGGTCAGATCGCCTCGGTGGTCTCAATGCAGCAGAACCTCAAAGTCGGGGGTCACCACAAGGTGGCGCTCCACGTTGCCCAGCATGC
TCAAGTGCTTGTCGGTAGTGTTGACGGCATAGATCTCCTCGCAAAAGGACGGCGTCTGGGCCGCTGCCACCTCAAACTGCTTGTCGCCAAGCACCAGCAC
CATCTTGCCGGACTTGTGTACGCAAATCTATCCACACGAAAGCAATTAGATCTTGCAAGTCTACCGAGCCAGCTATGCCCTCTATTACCTTGCCAACGAA
TCCCCCCGGCGCCGTCTCAATAGAGTGATCAAACACGCCATCATCCCTGCATACAGAGCATGTCAAACCAGTTAGATTCACCTCATACTTCAATTCCAAT
CATTGCACGCACGGCGACTCTTCCGGGTTTGCCTTCTTGGTTTCCTGCTTTGTCTCCTCCGCGCTCTCCATGGATTCATCTTCATCAGTGCTTGTAGTAG
GCATTTTCGTAATTGTACTCGACAGCGGCAGCGTCGTCGGCATCTGAATGAAAAACAGCGAGTCATCGGGGGCCACCACGTCCCCGGAGGCATCGCAGAA
GACGGCACCAGCGCTCTGAGGCTCCGGCGGGCGCACGATCGGCAGGCTCATGGGCTCCATTACCGACTTGACCACTGGTGGCCACACTTCGTCTACCTCC
ATACCCTCCGGTTGCTTTCCTCCAAGCATCTCCTCGTCGTCCAGCACACTGATACCAGTGCCTCCAGCGGCTGAAAAGTCGGCGGCTGACATAGCACGCG
GGGCCGGCGCGTTGCCACCTCCGCTGTAAGAAGACCCACCGGACAATGTGCCGACGAACGCGACCTTGCCACTGGGCATCACGCCCCGTCCTCGACCACG
ACCACGGCCGCCGCTACGACCTCCTCTGCCTCTGCCTCCACGGCCTCTGTTGTCGATCTTGAGCGCTCCAGCGCCGGTGGAGTGTGGCTTCGCATCATTG
GAGCGCTGTGGGCCTGGGGCGCTTCCTTCAGCACGTCCTTCCGAGGCTGGACGGCGCTTCGCAGCCTTTGGGACGAACTTGGGCCGCCGGGCAGGAGCAG
CGGACGCGTCGGTGGATGTGCGCAGGGACCTGGGGATGGAGAGAATTAGAAGGAGATGCTAGATGCAATATTTACATATCAACGTACGTGAGGCGCGCGC
TGGACGCGTCCACGCGCGGGCGCATGGTGCCGTCGCTG