Description :
From Genome Similarity Track
Location :
Scaffold_236:18025- 19555
Transcript NameFunction/comments
g15593.t1hypothetical protein

Sequence
1530 bases(100 bases per row)
TTATTACTATTGACGCCACGTCACAGCTGAACGGATCGGAAGGCTTTGCTTGCCTTCGTGATGCGTATCTAATGCTGCCGTACAAGGTCTCGATGCGAAA
TGGTGCTACTGCTCAGACGGCTGCTACTCGTTTCTGCTCTACTCTAAAATGTGGAAACTGAAATGTAATTGATTCGATGTCGCTGGAACTCAATGGAAAA
ACCATCGTGTCTATGGCGGACTACAAGATGTTTTGGAATAACATCCGCGCTCAAACCAGCTATTCTACTCAGTATGTTGAGAAGCATGGTGCTGAGTCGT
TCTTATACCAAGATGCTTCCCAGTCTGCTTCTTGCAGTGCTGCGGTAACTTCAACCGTAGGAGATGGATATAGCAACAACAATGCTTTCTCGAGCATGTT
TAATGTATCTAATCGCCCTGCCTCCATTCCTAATGATGGCTTCGTGAAGCGATTGTTATCGAACCCCCCAAATGCGGGTATTGATTTCGCCGCTACTTGG
CCTTCTCTCGGCGGACCAGCTGCATCTACCAATATCGCGAATCAAACGGCACGTGGTGCATTCGTTGCTGGAGCAGCCGTTGCTAACATGGGTACGTGGA
ACTACACGCTAAAGATCAAGCTAACGGACCTTCGCCCGGTCTTCAAGGAGGTTGACCTCTTGGCCAATCCTCAGATTCGTCTTCGCTTCCGCGTCAACCA
TGGGTCGTCTGTTGTTGCTGTAGATTCAAGTAAGGGCATGACGCTAACCTCTCCTACACTTTCGAGTGGAAACACCTGCCCTGTTATGGTTTCGGCCTCT
TCTAATGGAAACCCTATGAATGGAGTTCTTGCACCTTCTGCTAGTGGGTTAGCATCGCTTGGGGCGCCGTTGTCAATTCACTAGAACCTACCCTAGATGG
TACTACATGCCTTTACTACCTCTCGTCTGTATGTACCGTTCGTTCATCTAGAAAACCCTCAAGCTATCATTTCAAAGTCTGTCAAGAAGGTGCGCTACAA
TGACGTATATGCCCAGCGATTCGACCAACGCGCTGGTATTGGTAAGCAAACGAGTCAGTTCAACGCATCCTTTGACCTACAGCTATCAGCGAGTGTTAGG
AATGCTAAGTACATTTGACACGTGGCGACTGGACGTAAAATGTCCGAGCGTCGTCTCCCATTTCCCATGGAAGCACTCGCAGTGATGATTGGTCCAGAAG
TGCGCGCGACAGGGAAGAACGAGGATGAACGGAGAACTGGTACAAGTTCCCACAGCATACTGAGACCAAGTGACTTCCAGAAGTCCTCCCAATGTCGAGT
TACTTCCTGATGTGACTCGCAGATGACCCAGACGTTCTGGGTGCGGAGCCGACCAGACGCTCCTGATTTGTACCCACCAAGACCTTTCCGATTTTCCAGT
ATACAAAGCCCAAGATATTAGCGACCGACCAAGACGACCAGCCGGATATGTTATGCACGAAGAGCCGCCTTGCGACCAGGATGTGTCAGCCTCCCGGATG
CTGATTACGCCAAAGAACCCTATAGTGAAA