Description :
From Genome Similarity Track
Location :
Scaffold_6:180203- 182891
Sequence
2688 bases(100 bases per row)
TACGGCTTAAGGAGGCCAACGTAAAACACGGGGTGTGTACGCGATTTGCGCGGTAAGTTGAGCGTATAAGCAAGACCCTTCTTGGCCACGACCGTAAATG
GTCCAATGAAGCGAGGACGCAGCTTAGTCTTAAACACAACAGACACTACATTTGTAGGTAGGTTTTTAGCGTTTAGTAAGACTTGGTCACCGACCTCATA
ACTTTCAATACAGCTTCTGACTTTAGTATACACTTGTTTCTTCTGTTTGTCTTGGCTATCATCCCTTGCGTCACGCACATGTCGTAATACATTCAATCGC
GTTGTGAGGAACGCGCTAACCTGTTTGTAAACAGTAGAAGGGCTGATATCAACAAGCCGATCGGCTACCTCTACCCCACCAAGCCTTGAGCCACGTAGTG
GTAGCGTCAACGAAACGCGGGGTGGGGTGAGGCCGCTCACGTAGAACGGAGTATAGTCTGTCGAGACATGGACGGCATTGTTCATAGCAACTCAACAATG
GAGAGAATTGAGCTCCAACGCCGAGGCGTCTCAGCACATACGCTGCGTAAGACATCACCGAGGACGAGATTGACACGCTCAGTCTGACCATCGGTCTGCG
GATGATCCGCAGTAGACATGTCTAATCTGGTGCCGAGCACCTTGAAGATGGCCTTCCAGAACTTGCCTGTAAAACGAGGATCACGGTCAGAGACAATTGC
CAGTGGCAGTCCGTGTTGGCGAAACACGCGATAAACGAACAGCAAAGCTGTACCTTCACCATCAATCGAATCCGGCACAGCCGCTAAGTGAACCATTTTG
CTCAAACGGTCGAAGAAGACCACAATACCTGTGTTGCCATCCGAATCCTTCAGTAGGTCAAACACGAAGTCCATGCTGATGGACTCACAACACCCAGAGG
GTACAGGCAAACTAGCCAGCGGTGCAGTCACATATGCCGATGTTTTGACCCGTTGGCACGTCTCTTATGTGCGCACATAAGTGCTTACCCATTTATAGAG
TTTGAGCCACCAATAACTCTGGCTAACCAAGCCGTAGGTCTTCTCACGACCGAGATGACCGCTAATAGCTGTGTCGTGGACCTTATAGAGGATTCGATAC
TTCAGTTCCTAAACATGGGGAACAATAATACGCGGGGTATCCGCGGCATCCGTGCGATAGCACAACTAGCCGTTATCGATAGAATATCGATGTAGCCTCG
CACGAGAACGTGCCGACAATTTACTGTCTGAGTCTTTAAACTCATCGCTTCCAAGAGCACGTAGCAAGGCTACACATTGTTCATTCTTAAAATGATATGC
ACGGAATAAGTCAGTAATTGACGACGACAAAATCGTAACATGAGCAAGATCATAGTCGGGCCGTTGTGACAGCGCATCAGCAAGCGTATTTTGCTTTCCC
GGCTTATACTTCACCTCGAAGTTATATTCTGCAAAGAATTAAAGCGAACGGGCCATCCTCTGCGAGAGGTGAGGCGATTGGTTCGCCGTGCGTAAAGACG
CATGATCGGTATAGACTACAAAAGGCTTAGAGCCAAGCAGACGAACACTGAGTTTGACTAGAGTATACTTCATAGCAAGTATCACCTTGTCGTGAACTGG
ATAGTTCTTTTCGGTAGCTTTAAGCTGACGGGATTTAAAATGGATGACACGCTCACGTCCCTCAAAATCTGTTTGTAACAGAGCACAGCCAATGGCAAAA
TCCGAAGCGTCACAGACGACACTGAAAGGCCGATCAGAATATGGCAAAGCCAAAATCGGCGCATGTAGGAGACTCTTCTTTACGGCCTTAAAATCCTCTG
CTTCGGTGCTAGTCCAGCACCACTACACATCCTTTTAAGGAGATTGGATAATGGCCGAGCCATATCAGCGTAATTCTCACTATACTTGTGCAAGTAATTG
GCAAGGCCAAGCCATTTGCGTAGGTCCTTTTGGTTCTTAGGAACTGGACAATCTACTATGGCCTTTACCTTTGCAGGATCTTCCCGAAGGCTTCGCTTCC
CAATGAAGCATCCCAAAAATAGGATCTCATCTACACCAAAGATACATTTTGACGCATTAGCATAGAGCTTATTAGTGCGCATGCACTCGAGCACAGCTCG
TAAATGGTCGATGTGATTATCCACGTCCGACTGACTCTGCTCCGCCCGACTATGGACAAATATGTCATCACAATATGTTTGTGCATACGCACGGTGAGGG
CGGAACAATTGCGTCACCAGACGATTAAACGTATCCGGGGCATTGGAAAGTCCCTGGGGCATAACCAGCCACTCCCAAAGCATACCGCTTGGTTTACTAA
ACGCTGTAAGCGGGATATCACTTGCTCGCATGAGCAGTTGATAATAACTATCGACCAGGTCGAGTGCACTGTACATTGTACATCCTGCCATGTTGTTCTG
AAGAACGTCCTTTCTAGAAATGGGTGTTTGTGCTGGTATAGTACCGCATTAAGCTTACTATAAGCGTGTACAATACGTCACTTACCATTAAGCTTTTTGA
CACAAAATGTCGGTGTGGAATGATGATAATTACTCTCCCGCACCATTCCTGCCGCGTTCTTAGCACTAAAAAAACTCGTCAATGACGTCACTTTGTTCCT
TTGGTAAATGCCACTGCCTTGTAACGCAGTATTTGGTTCCAGGAACCAAGTCAATTTCGTGACGTACGCCCCTATCGGGAGGTAATCC