Description :
From Genome Similarity Track
Location :
Scaffold_82:18012- 24781
Transcript NameFunction/comments
Physo_140101hypothetical protein
Physo_140102hypothetical protein

Sequence
6769 bases(100 bases per row)
CCCCTCACTGGATCCAATTGGACAGATCAAGCTCGTCGAGACACTGCGTCGGCATGAAGAGATCATGATCGCCAGTGGCAACGCACTACCGCCGCCTGCG
TACGGCGCGGTGTGCGACATTGATGTTCAAGGCAACGCCCCTATCAAGCAAAGAGCTCGGCGAATTCCGCTGAAATACTTGCGGAAGCTCTATGAGCTGC
TGAAAGGGCTGCTGGAGGCAGGACTCATTGCGTTCTCATCCAGTCCGTGGGCCTCGCCGATCGTAATCGTGCTCAAGAAGAACGGCCTCGATATACGGCT
ATGAATCGACTACAAGATGGTCAACGCAATTACGCTCATTATGGAATATGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNATGCCGTTGGTCGACGATCTACTCACAGAAATGGAGAGCTACTCGTGGTTTTGTTCGCTGGATGCTGCCAGCGGTTTCTGGGCGATCATGATGACGAT
GCGTGCTCGGTGTGTGTTGGCGTTTGTCTGCGCGCTAGGTCACTTCGAGTGGCTGCGCATGCCGTTCGGTTTGAAGAACACGCCGATGATCTACCAGCGA
ATGATTGGAAACTCATTGTGGGGCTACGTGCAACCGAAAGGCGGCTGGGAGGCTTGCGCCGAGCGAATGAAGCAGGCAGAAGCTAAGGCTCAAGCTCTAC
GTAAGGAGTTTGTGGTGAAGTCGCAGAGGTCGCCGAGTGTCGATCGACGCGACCTGCGGACGGTATACGAAGCGGATCACCTGGCCCTCGCCGGAAACGA
CCCGCTGATGGAGTTGGTCAACAGCCCGGATGCAGATATGTTCTCGACCGGCGAACCTGACCAGTCGAAGCTGGTCCCGGTGTTCCACCGTCATTCGTCG
ACGACATTTGCTTCGGCGGGTCGACGTTCGATGAGTGCTTGAAGACGCTGGACCGACTCCTGTCGAGATTCGCCGAGTGCGGGATCAGCGTCAGCTTCAC
GAAAAGCATATTCGTCCAGCCGAAAGTGGATTTCTTGCCGCATGTTGTCACGGGGGAAGGAATCCAGGCAGACGGAAAGAAACTCGCGGCAATCGCTGAG
CTCCCGTCCCCCTCGTCGAAGAAAGGAATGCAGGCGTTCCTGGGTGCCCTGAACTACTACGGGAGGTTCATCCAGGGATTGGCCGTGTACGGAGCTGTGT
TGTACCAGATAAAGGAGGACGACTTCGCACCGGGGGGTGACCTCAGCGTTGCCCGCAATGCCTTTACAGCGTTACGCCAGAAGGTCGTCGAGGCACCGAT
CCTGCGGCACTTCGACGGCTCCAAGGACGTCTACATCATGTTGTACGCCAACGAGTGGGCATTGAGCAGTACGCTCATGCAGATGCATGCCGACTTGCTC
CACCCGGTGCGGTTCTGCGGCCGGGTGCTCAAGGAGAACGAGCTCAACTAACATCCTGCAGAAAAGGAGGTGTTGGCTCTCCTACAGGTGCTCAAGGTGT
GCTATACGCTGTTGTCCGGTAAGACGTTGCACGTCTACACCAGGTTCTCAACTTTGGAGTGGGTGTTCCAGTCCAAGTCGTTATTCGAAAGGACGGTGCA
ATTCGCGGTGTTCCTGTCGCAGTGGCACCTGAAGGTCAAGCGAGTCCGCGAGCGTGACGTCGAATTCGCCAAGCTGCTGCAGTCGTCGATCACACCCTTT
GTGGCGCTCGACGAAGCAGTGGCCCCGCTCCACCGCCCTCGAAGGGGCTGGCCCCCCATCTGCTCTACGCGAGTATCCCTCGAGACTATGAAGGCCCTGT
GCTATCTTTCGATGGGTCAGCGAAGACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCCATCGACGACGGTCGATCT
AGCCGAATATACTGGCATGAACAACGGAGTCAAGGCGGCGATTGAACACGGGATGACCGATCTTATTATCGTCGGCGACTCCAGGCTTGCAATCCAGCAA
TCCATGGGGGTGATAGCCTGCCGGGCGGAGACGCTGCAAGTCAAGCTGAAGAATCACAAGGAACTCACGACGCAGCTCAACTCAGTCCGCTATCTGCACG
CCATAAGGATGTAACATATCTGCCGACTCGCTGGCCACGGAAGCTCTGGAAACCCAGGTCACCAAGGTGGTACTCAGCGAAACAAGGAAGGCGGAGCTCA
AAGCGCTCAATCGAATTCCAGAGGTGCTGTATGTCGATGAGCAAACCGCACTGGAGGCAGAGCGGAACACTCAACGAGCGGAAACCACTCAGCGAGCAAA
ACCTTCAAGTGCTGATGAGGTCACCGAAGAACCTCAAGTAACTGCAGTCACCAGAAGTCAAGCTCGGCGAGTGAGGTTCGAAGATCCCGAAGTGCAACGG
CACACTAACCACGGTGACGTGAGAAGTCAGGAGGTTGAACAGACAGAGCCAGAAGAGACGCCAACCCCTCCAGAAAACGCACCGGAGTCGGCGAGCGAAG
CAAACGAAGCGCAGATGCAAACGACGACATGATCACCAACGGACCAGCTCCTGCTACTCCTGAAGAAGTCGACGAACAACTAAACCCGGTAGCGGTGCAA
GCAGAACGCATACGGCGAGTCCGTATTGCCCAAGACGAAGAAAGGAGGTGGCCCGACTTGAAAGCCTACCTCCGGGGCGACATTGAGTCCCTCGACTTCA
AAAGGGCAGCCAATGCGGGCAAACTCGCCGACCGATTCGTCCTGGACGAAGACGACGTGCTACACTATGTGGGTAAGGGACGCAAGCTCGACGAGGGAGG
CGAGCCGGAACCTAAGCTGAGACTGGTGATACCGACGACGATAATTGAAGAAGTCCTGCAGAGTTGTCACGACTCGATCGAAGGAGGGCATCAAGGGATA
ACGCGCACGTTCCACCAGGTCAAGAAAGATTACTACTGGATTGGACTGTACGCCACGGTGGCTCGCCATGTGTGCGCATGCGCAGACTGCAGTACCAGCA
AGGGCAAACCCCAATTGAAGGGGTAGTCGCCGGGCAATGTGCTCGCCGACCGCCCGTTCCAGCTGGTATCGATGGACTTGGTGACGCCGCTGCCGAAGAC
TCGGCGAGGCAACACGTCTATGTTGCTGTTCCAGTGTTCCTTCACTGGCTACGTTATCGCCAAAGCCATGAGCAGCACCAAGGCACAAGACGTTGCAGAT
GTTTTCGAGGAATATGTGTTCCGACGCTTTGGTGCCCACGACACGATCGCGATCCACGCTTTATGAGTGAGACCTTCAAGGCATTCTTCGAGCTGTCCAG
TAGAGGTCTAGAGCGACGCTCAGCTACCGGCCCCAAGCGAACGGTCAGCAGGAGCGGTCGGTCAAGTCGGTGATCTAAGCCGTGAACGTGTACATCGAAG
ACCCACTCCAGCAGGACTGGGACGAGATAGCTTAGAAGATGGAGTATGCGATCAATAATTCGATGGACACAACGAGGAAGGAGACACCCTTCTACCTCGT
CCACGGATGGGATGCCCAATCGACACTCAAGGCAATGACAAGTTCGTTGAGACTCGGCGATGGTGATCAGACGGACGCTGCAGCCTGGAGACGCGAGGCC
AGCCGACAACACGAGATTGCTCTGGCAATGGCGAAACACTACCAAGCCACCGAAAAGGTTCGGCGAGCGAAAGAACGCAACGAAGCCCTTGGAAGAATTG
AACGGCTTGCTGTACCGCTCGACGAACGTGGCGATCCTGGCAAAGCAACGGTCGACGAATCAACGGGAAAACCGGTCCATCGCTCACTGTTCCAGCCAGG
GAGCCGGGTATGGTTGTTTATGGAGCGCGTGAAGCCCGGCCTGACCAAGAAGCTCGCTCACAGGTGGCATGGCCCTATCCGCATCAAACGGACGGTGGAG
GAGTTTGCCTACGAGCTAGAGCTACCTGACAAGACCGGTTACCGCTTCTATCCTGTGGTGCACGTGTCCAGACTCAAGGCAGTGAGCGAAGATGACCGCA
GACCGACTGCAGAACTGATCGACGGACTCGGCGAGGATGAGAGGTTTGATTTTGATGAGGAACTTCTGCCAGAGGACAGCTGGGATCCGGAAGGAGACGG
TGATAAGTACGTCGTCGAAGCTATTCTCGACGACCGATGGCCAATTTCGACAGGCACTGAACGGAAGCAGTGAGAGTTCTACATCAAGTGGCGAGACTAC
GATAAGCCCACTTGGGAACCAGTATCGAATTATCGTGCGGAGGACTACTATTCGACTATCTCCTCTAGCGCAAGCGCGCGAACCGCTTCAAGATGGTTCA
AGTTGCTGACGAAGACTAGCAACTGCGCGAAGTATCCCTCGGCGATGGACACAGGTCGCCGATCAAGGGATTGATGTTACTGTGTCACATGTNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCATGGCGGGCATGGAAGCTGCTCGTGGATCCTGTGGCGCTTACCGGCTTGGGACAT
TGTGATCGCTGCGAGTGCGCACCTGCCATCGACGACGGTCGATCTAGCCGAATATACTGGCATGAACAACGGAGTCAAGGCGGCGATTGAACACGGGATG
ACCGATCTTATTATCGTCGGCGACTCCAGGCTTGCAATCCAGCAATCCATGGGGGTGATAGCCTGCCGGGCGGAGACGCTGCAAGTCAAGCTGAAGAATC
ACAAGGAACTCACGACGCAGCTCAACTCAGTCCGCTATCTGCACGCCATAAGGATGTAACATATCTGCCGACTCGCTGGCCACGGAAGCTCTGGAAACCC
AGGTCACCAAGGTGGTACTCAGCGAAACAAGGAAGGCGGAGCTCAAAGCGCTCAATCGAATTCCAGAGGTGCTGTATGTCGATGAGCAAACCGCACTGGA
GGCAGAGCGGAACACTCAACGAGCGGAAACCACTCAGCGAGCAAAACCTTCAAGTGCTGATGAGGTCACCGAAGAACCTCAAGTAACTGCAGTCACCAGA
AGTCAAGCTCGGCGAGTGAGGTTCGAAGATCCCGAAGTGCAACGGCACACTAACCACGGTGACGTGAGAAGTCAGGAGGTTGAACAGACAGAGCCAGAAG
AGACGCCAACCCCTCCAGAAAACGCACCGGAGTCGGCGAGCGAAGCAAACGAAGCGCAGATGCAAACGACGACATGATCACCAACGGACCAGCTCCTGCT
ACTCCTGAAGAAGTCGACGAACAACTAAACCCGGTAGCGGTGCAAGCAGAACGCATACGGCGAGTCCGTATTGCCCAAGACGAAGAAAGGAGGTGGCCCG
ACTTGAAAGCCTACCTCCGGGGCGACATTGAGTCCCTCGACTTCAAAAGGGCAGCCAATGCGGGCAAACTCGCCGACCGATTCGTCCTGGACGAAGACGA
CGTGCTACACTATGTGGGTAAGGGACGCAAGCTCGACGAGGGAGGCGAGCCGGAACCTAAGCTGAGACTGGTGATACCGACGACGATAATTGAAGAAGTC
CTGCAGAGTTGTCACGACTCGATCGAAGGAGGGCATCAAGGGATAACGCGCACGTTCCACCAGGTCAAGAAAGATTACTACTGGATTGGACTGTACGCCA
CGGTGGCTCGCCATGTGTGCGCATGCGCAGACTGCAGTACCAGCAAGGGCAAACCCCAATTGAAGGGGTAGTCGCCGGGCAATGTGCTCGCCGACCGCCC
GTTCCAGCTGGTATCGATGGACTTGGTGACGCCGCTGCCGAAGACTCGGCGAGGCAACACGTCTATGTTGCTGTTCCAGTGTTCCTTCACTGGCTACGTT
ATCGCCAAAGCCATGAGCAGCACCAAGGCACAAGACGTTGCAGATGTTTTCGAGGAATATGTGTTCCGACGCTTTGGTGCCCACGACACGATCGCGATCC
ACGCTTTATGAGTGAGACCTTCAAGGCATTCTTCGAGCTGTCCAGTAGAGGTCTAGAGCGACGCTCAGCTACCGGCCCCAAGCGAACGGTCAGCAGGAGC
GGTCGGTCAAGTCGGTGATCTAAGCCGTGAACGTGTACATCGAAGACCCACTCCAGCAGGACTGGGACGAGATAGCTTAGAAGATGGAGTATGCGATCAA
TAATTCGATGGACACAACGAGGAAGGAGACACCCTTCTACCTCGTCCACGGATGGGATGCCCAATCGACACTCAAGGCAATGACAAGTTCGTTGAGACTC
GGCGATGGTGATCAGACGGACGCTGCAGCCTGGAGACGCGAGGCCAGCCGACAACACGAGATTGCTCTGGCAATGGCGAAACACTACCAAGCCACCGAAA
AGGTTCGGCGAGCGAAAGAACGCAACGAAGCCCTTGGAAGAATTGAACGGCTTGCTGTACCGCTCGACGAACGTGGCGATCCTGGCAAAGCAACGGTCGA
CGAATCAACGGGAAAACCGGTCCATCGCTCACTGTTCCAGCCAGGGAGCCGGGTATGGTTGTTTATGGAGCGCGTGAAGCCCGGCCTGACCAAGAAGCTC
GCTCACAGGTGGCATGGCCCTATCCGCATCAAACGGACGGTGGAGGAGTTTGCCTACGAGCTAGAGCTACCTGACAAGACCGGTTACCGCTTCTATCCTG
TGGTGCACGTGTCCAGACTCAAGGCAGTGAGCGAAGATGACCGCAGACCGACTGCAGAACTGATCGACGGACTCGGCGAGGATGAGAGGTTTGATTTTGA
TGAGGAACTTCTGCCAGAGGACAGCTGGGATCCGGAAGGAGACGGTGATAAGTACGTCGTCGAAGCTAT