Description :
From Genome Similarity Track
Location :
Scaffold_21:180119- 181907
Transcript NameFunction/comments
Hyaar_Emoy2803585hypothetical protein
Hyaar_Emoy2803586hypothetical protein

Sequence
1788 bases(100 bases per row)
CTGACAGGTGGAGGTGACGTTTTCAGTCACTTACTCGCTTGCTGTGCAACGTGTCTCATTGCTTGATGCAGCACTTAATTACTAGTCAAGTACATTGCCG
AGTTGGAAGGCGCGTGCATGCACTTGGTTGTCTCGTTTGCTGTTGCAAACTCTATTGCGTCTGTGTGTCGTTGCTTCCAGGTCGACTGTAGGAAGGATGG
TGTGCTGTCCAATGCGATTCAGAGGTCCTGGCGGTGGAGTTTGAAGGCAGTGAGAGCAAAGGACTTGAAGCGGTGCGACTGCAGACGCTCGGTTAGGGCT
GAATTCATATAGAGCCAGGGTTCCCACAACAGAAGGTTGTCCTGCGGACATCTACTAACCAGCTGATACCGTCTACGTCGTATACCATCTCATCACTTGT
ACGATCACGTCATTGAGGTCTCGAGTATGTCTGATGGGCTGGCGAGCGCACTGCTAATAAGTGAGCTAGAAGCTGCTTTCATCTAACTGGACGCAGGTTC
TTACACTGACTTCCTGCAGCTGTTACAAACAGAGTCGGTGCAAGCACTGGAATTCCACGCAAAGTCCACTCACTGTATGTTGTTTATGATCAGTTATTCT
ACAGTACATACGTACGTAACGGTGATAGTAATGGCAGGAAGTGGCCGTACGGCATTGGGTATCTCCAGCTAACAGGACTACTTGCGAAAACTATCTTGGG
CATCGCTCACACACTCTACTCTTCACATTCTGCTCGTGTCGGTAATCATCATCTCCGCACTCGACAGATTGAGCCTTCCTCGGAAAAGAACACGGGTCCG
TCGATGTATTTTACAGTTGCCTTACAGTTTCCAAGCAGCCAAAGTCCAAGCATGATCACCTTCCATCTAACGCGAGACAAGTGCTGCCATTCCGTCCATT
CCACTCTCGAAAAAATCATGCGCTGCTATTGAGCATCTCCCATGTAATTTGCAAGTCGAGGTCTCCTTCGTGAGTGCACAAATGTTCCATGTTGGCATGG
ATGAGCTCCACTTCTAGCTGCAGATCGCTAATCTTCGGGTACGCAATGAATTTCATCGACTTGCCATGGCATGCATCCATGGCCTGCATCTTGACGTTGA
TCAACGCCTCGCGCTCTGTCGGGCCATCGCCGAGCGAGATGACATGCCGCGGGATTCCTGCCGAGTCTTCCTCGTTGTATGACTCCCACACCGGAAATAC
TTCATTGTTAAACGCCTCCACTTTCCACCGACGCGGACAGTCTGGATACAAGTACTCGTACGTCGAGCGCGCTGAGACGACTTTGATCCGCGTGTTGAAG
AACGGGACCAGGCGTGGCATAAATAGCGACGCGGATAACTCCACCCATCCAGCCTCCGCAGCCGTCACAATGACCACGCGTCCATACGACAGCGCGGTCT
CAAGGAGTTGCACGACAGAATCTTCAAGCTCTTGCAGCTCTGCTTGCACGTCGTCCGGGATCTCGGGCTCCTCGTTAATGTACTTGGGGCAAAGGCCGTG
CTTGGCAATAGCTGACGACGCCATAAGCGTATCATCTACAAAATGGGTATAACCAAATGCACATACACCAAAACGAGCGTAAGATAACCAACGTTGCTAT
AGCACATGCTAGACAGATGAGAGAGCTCACCCCAATCAAAGAAAATGACTACGTCCTCCGGGTCGTGCTTGCCACTGCGCGGACTCACGACGTCGTAGCT
GTCAAGAGAGAGACTGCTATGACAGTCCTCGACACACACGTCTCCACTGAGGTTCATATTAGGCGCCATCACGACTGCGTCAAGCTTG