Description :
From Genome Similarity Track
Location :
scaffold_66:1801- 21882
Transcript NameFunction/comments
Pl_110609peroxisomal multifunctional enzyme, putative
Pl_110610hypothetical protein PHYSODRAFT_353725
Pl_110611hypothetical protein PHYSODRAFT_470141
Pl_110612hypothetical protein PITG_23207
Pl_110613conserved hypothetical protein
Pl_110614hypothetical protein PHYSODRAFT_310135
Pl_110615hypothetical protein PHYSODRAFT_349450
Pl_110616calcium-dependent protein 5
Pl_110617conserved hypothetical protein
Pl_110618conserved hypothetical protein
Pl_110619hypothetical protein PITG_02619
Pl_110620conserved hypothetical protein
Pl_110621hypothetical protein PHYSODRAFT_344165
Pl_110622hypothetical protein PHYSODRAFT_476843

Sequence
20081 bases(100 bases per row)
GTCTAACCTTTTGTTATGCTGCCTCTATTTCAGTGTTGTGAACGACTTTAGCAAGGAGGCTGCGGACTCGGTGGTCAATGAGATCAAGGCTAAGGGTGCG
TGGGTAGAAGACTCCTGGGTAGTGGAACAAGCGTGAGTACTAACTGGCTGTTGTTCAGGTGGGGTCGCGGTCGCCAACTACAACTCGGTGACGGACGGTG
AGAAGGTGGTGGCCACTGCCATCGAGAACTTTGGTCGTGTGGACATCCTGGTGAACAACGCAGGCATTCTACGTGACGTCACCTTCGCCAAGATGACTAA
AGCCCAGTGGAACCAGGTGCTCGACGTGCACCTCCAAGGAAGTACGTGACAGCGAACATCATCTACTTAGTGTATAGTTTGTTATAGTCACTTACGTTCT
GTATTGTCATTTGCAGCGTTTGCGGTGACCCACGCGGCGTGGCCTCACATGCGCAAGCAGAAGTATGGTCGTGTGATTCTGATCACGTCGGTGAACGGTC
TATACGGCCAGTTCGGTCAGACCAACTACAGCTCCGCGAAGGCTGCCATGACTGGTTTCGGCAAATCTTTGGCCAAGGAGGGTGCTCGCTCGAACGTTAA
GGTGAACATTGTGGCACCTGGCGCCGGTTCCAAGATGACCGAGACGATTATGCCTGCGGACCTCGTGGCAAAGTGGAAGCCCGAGTACGTGGCACCAACG
ATCGCTTACCTATGCCACGAATCTGTGCCGTGTTCGGGCAAGATCTTCGAGAGCGGTGGTGGCTTCGTTGGTCAGGTCAAATATGTGCGCAGTGCTGGTG
TGTTCCTTGACTTGGAGAAAGAGATCACGCCCGAAGCGGTGCAAGCCAAGTTTGCGCAGATCACAGACTTCAGTAATGCCACGGATCCCGACGATGATGA
GGTTGCTCCCCAGCTCAAGCAGATCGTGAGCGCCAAGCTGTAAGAGTCGAACACATCAATTGAAGTAACGATCGGTAGTCGTAACGAAATGAATGAGACG
TGTTTATGTGCCACACATTGTTGTTAAAAGTAACCAATAAGTAACTGTTGAGTAGTCTGAAAATTCCTAATCATTCGACAAAGACATCAGTCAAAGAGAA
GACAGCAGTAGGTAGCCAAGGGAACGAGCGATGATCCGTCTCAAAGCCAAGCAAGCAGAGAAGAAAGCCGAAGAGAAGGAGGCAGCTGCTGCTGCGGAGT
CAGGCGATGCAACGGCAGCCCCGAAGCCCAAGACGAAGATCCTTGGCGTGGGTCGCGGCAAACGTGGAGGCTCCAGCAAGGAGAAGAAGCGCACGCCCGG
CGAGATCCGCATTCAGAAAGGTAGCGACAATAGAGAGAGAGACTGAGTAGAGGATATGGGGCTGACTTTTGAGGTGTGGGTTGAAGATATCGCGGAGCTG
GATGGCGGTAAGGCGGCGACGGTCTCGTTCCCGGAGGTGAACGACCTCACGGTGTTTAATGTCAAGGTATGGAGCTTTAGGGATTATACTGGCATTATTA
TGTGGAGACTGAGCAATGGTTTTGCAGATTGCAGTGGATACGGGACTCTGGAAAGGCGCGTCATACAACTTCAGCTTTAAGATCCCTCCTGTATGTTGCG
TGTGGAGAGTTCGACATTGGAAGGAGACTGATGTGATTGTGTTGTGCAGATGTATCCGCATGATCCACCTAAGGTGCACTGCTTGACGAAGGTAAGTTGT
ATCAATCACTGGTTGAACATCATTGGTTAGTGCAAAGCATAAAAGATAACGTGGTTTCCGTAATTGCAGATTTACCACCCGAACATTGACCTTGAAGGAA
ACGTGTGTCTGAACATCCTGCGTGAGGATTGGAAACCTGTGCTGGATATCAACTCAGTCATCTATGGTTTGATCTACTTGTTCTACGAGCCGAACCCGGA
TGACCCACTGAATAAAGGTTCGGTGTATTTGGGTTAGTGGGAGACAAGAGTTATTGGATCTGACAAGAGTATGTTCTGTTGTGTCCTACCTTGCTGCTTG
AGTAGAAGCTGCCGAGCTGTTCCGTAACGACCACAAGCAATTTGCCGCATTGGTGCATCGATCTTTGCGTGGGTACAGCGTCCAAGGCATCGAGTTTGAG
CAGCTGATTTAAACTCGCGCAGTCAACCAAGTAGTTTCTCGAAGTGGCCAATTGATCAGCCAAAGTTTTAAGGCCTAGCATCATAGACAGCACCAAGGTC
ACGGTGGATTAGCAACTACTTAATCGAGCTGGTGTTTTGGCTCAACGCCTGCTTTGTACATTTCGTTATTTTATTTTCTTCGCAGCATGGGTGCTGCCAT
CTATCGTCTTCCAGTAGCTTGTGGAGAAGAAGGGTGCCGATCAAGAGAAGAGTGATGACGAGGTGTTGCTACGAAATGTAGATGGCCTCAATCTCTTCAG
ACGTACTATCGCGAAGGACGTTTTCCTGTCAACGAAAGCAACATAATCAGCACAGTAAACAGACGAATACAGCAAATGATCACGAACCCGCTCTAGCTTG
CACTTTCCGCCGACAGCAAGGTTGAGAGAGTACTCGTAAAAGTAGCCATCAGCGGTTGCTACATACAACTGTACAATTGGGTTCTTAGCATCTCGCGGGC
CGTGAACTGCACATTGGTTCGGTACTCCCGTTGACCGTAAGCGAGCCTGACAACATATCAACCACAGTTAGAGCAAGTGATTGCATTCCGACTACACGAG
AATGCACGTACATATGCAAAGTCGCGAGTGCCCTCAGCGATGCCCGAAAAGGAGCTAGGTAAATATGCACTCATGACGCCAGCGACATCGTCAAAGTTGC
TAACAGCAGAGCTCGAGCTGGTGCGAGTCGTTCGCACGGGGGCTGACACGCCAGCAGTAGCAGGATGCATCGATGGTGTACCGGGCGAAGTTCCTAGAGC
TGGCGAGGCTATCGGACTCGGTGGAGCGAGAGCAGTACCAAACACAGTGGAGCCGAAGGTACTTCCCGCAACTGCGAGAGTAGATGTGATAGGGGTAAAG
TGGCCAAAGCTACCTGTAGCAGAACTCTCGGCTCCGGTCAGCGAGAAAAAATGAATTGTGCCCGTGTCGCTGGATGCACATAGAATCGTGGAGCTTTCGT
TAAACGCTAAGCAGTAAACTTGAGCGCCGTACGAACCACGTCGAAAGGCTGCAACCTTTTTCCCACTTGGTACAGCAAATACCCGGATCAATGTCCCCTG
TCATCAACAACGTTACCTCAAGTTCATAAAAGCAAATGACCACGACTTTCTTACCGATTCGGAAGCGGTCGCCAGTAATGTACCTTGCGGATTGAACGCC
ATGGCCACAGGTGCTGTACGGTGGGCTTGAAATGCATTTAGAACACTAAGATTATTGGCATCATACAGCACGATCTCTCCTGGCGAAGCACCGGATGGGA
ATGCGAGATGGCCATTGTCGTGTGGAGACAGCACACACAGTGCCTTTGGGTTCGGCGACGTGTCCAACGTCTCCAAAATCTTCATAGTGCTGATGTCGAA
AATGTAAATCTTGCGCTCCAAAACGGCCACCAGCCTACAAAAAACACATCAGTCTCCTATCAAATAAAATCAACAAACATTACCTCTGTCGATTCATGCG
CACAGCGAGCACGGCCGTGACAAAGTTCAAATCACATATTGCAGCCCCCGTCTTGGTGTTCCATACGCGCAGTCGACGTGGCGAGAACGCAGGCTGAACG
AAGCAGTAGACACCATGCGTCACTAGCTGTACAACTGCAGAGACCGAAAAGCCAATGAACCGACCTGGTCTCCAGCACCCACAAGAGCCACCAGACTGGT
GCAATACAGCATCTCAGCAATGCCGATACCCCCGATGTCTTCCTGGAAGCATTTGCCGAACGGTTCGCAGTTGTAGATGGCGAAACCTCGGCGGGTGCCT
ACGCTGATGCATCTGAAAATAAGGAACGACACAACCATTGGTACACCTCGTATTGTTGATGAACTAGGGAGGTGAATACGTACGATGCCTCCTGGTTGAA
ATTCAGGAAGAGCAGGTCAGTGCGGCTACTCTCAGAGCTCCTCATTCTTCTTCTTTGTCAGGAAGTGTTAAACTTGATATTTGTATTGTTATTTTAGCCA
ATCATGTAGCTAGAGGACAACATTAAGTTCAAGACAACTTCAACTAAACTTCAGGTCGGATGTCAACTTTCTCCACTCTTGGTACATGCAGTGGTCTGCA
TGAATTACTATACCATCGTTTTGAATGACTAAAGTTGTTTGGTTTCGTGAAAACGAGTAGTTTCATATGAGGAATGCATCGTTGCCGCTGAGTAGCACCA
CATTTTAGTCTAGCAAGTCAAGTATAGGGGATATGACGATACGCGAGCGCTGTAAACACAACTCAAGCTTTGTTTTGCAAAACATACGAAGATAGGAATA
AAGATACGGAGCTTCAAGAACCACTGCATGTAGAGGCTTTCAGAAGGATAGGATATTTCCCAAAAAGAATCAAATCAACGAAACCTCCATAACATCTATA
GTTGAATATGGACTTCTTCTCTGAGTGCGTACGATCTGCAACCACGGTAGGCTAGTCGTTTGTGCTTACAACTTATCGATACTCGTGTAGTTAGTAGCTT
CCCATCCACTGATTCGGTAGGAAACACCTCGTAAACTCCTCTACTTTTGGTTCCTCCATTCACTTTTATCATTATCAGTCGGTGCTCGGCCAACACCCAC
ATTTTTCAATTCATCTCTCAGGAAGACCACGCCAGCACAAACTCGAAGCACGGAAATGAAATTTTACGTGCTGGTTGCCGCAACTACGCTAGTCACACTA
GATTCGGCTTTGGGTATGCGCCAATTCCTCCAGGAGCTCCCGAACGGCAGCTTGTTTCAACAGGCTCTCGGTCATCCTGTCGACGACAGCTCACAGGAGA
CTGACTTTGCCCAAGCGTTCGACAATGCCGGGCAATCGTGGACTAAGAGTCTGTGTGAGGCCAAGTTCCCCGGTTCAAGCATGACCAACGGCCAGGCTTT
TGGAGATCCTTGCTGTACATGGAAAAAGGGAGGCAAGCCTGACTTTACTGTCACCGCGTTCACAACGACTCCAGGTAAGGCTACCACGTGCGCCTCGAAC
GGATCACCCAGTTCAGGTTCTGAAGCTGCTAAGGGTTCTTCTGGTGGGGCCTCGGATGCCACAAAGGGCTCGGCACCAGCTTCTGATGCCACTAAGGGCA
ATATCTGGGGATCGACTCCATCTCCTTCGACGCGCTGCAAGGGCAAGAAGACACTTTGACAATAAGACAGCAATATCAGTGCTAAGTTCTCAAGAAGTTC
TCTGCGCGGATCTCTCCAGCATTAGTACTTCTTCAAAAAGATGTACGATGCAAGACAATGTGTGTCTGTCAAGCTTGAACAAGTTGTAGTGAATTCCTAT
CAAATTTACCCCGAACATTGTTCTCTTTATTTCATCCTTCTGTCATGATGGACTTGAAGGCGGAAAGCAACTTGGTTGTGAATCACAACTTGTGATAGAT
CATGCCGTCACAGTGAGCAAAGACCACCACAACGATGTGAAATGTCCGAGATTTGTACATGCGCCCGCCTCAAATTTTGCTGTCTGTAAGATGTATTTCC
CATCCGCAGATATGGAAAACAGCACTTCCCACGTATTATCTTCTTGGTCACCCCATCGTTCCATCCTCGATTCAATTTTATCCGTAGAGTATCGATTAGA
GTGTGGAAAAGCTGCATGGCAAAGCCAAAACTTGGTCGTGTGTTCTCACTTCACAATTTGCTCGCACCACCAGAAACAACCCGAACAAACGCACGAAAAT
GAAGATTCAAGTGATTGCCACTGCTGCTCTGACCATCGCTGCAACGATGGACTTGGCTTATGGCCTCGCCAAATACCTCAACGAACTCCCGAACGGCAGT
TTGTTCGAGCAAGCACTGGGCCACCCCGGTGACGATAGTTCAAAGCAAACGGACTTTGCTAAGGCATTTGCAGCTGCTGGTCACACGTGGTCCAGCAGTT
TGTGTAAAGCGAAGTTCCCCGGCTCGAGTATGACCAATGGTGCCGCATTCGGCGACCCGTGTTGCACGTGGAAGAAGGGTGGTAAGCCGGACTTCACGGT
GACGGCCTTCACAACTACACCAGGAAAGGCCACAACGTGTGCGTCGAAAGGAGGTTCGAGTGGAACATCTTCGGCAGGTGGAGCAACGCCTGCTGCCAGC
TCGTCAGGGGCTGGCGATGCCACTAAGGGTGGTACTACCGACACTACCGGGAGTTCTGACAGCGGTGCAGCTGATGCTACCAAGGGAGGTGCTACGACCG
GTGGCTCAACGAGTGGAGCGGGCGATGCTACTAAGGGCTCTCCTTGGGGGTCGAGCTCCACCCCAACGTCAGGCGGTGGTTGTGGTGTCAAGAGAACTCT
GCGCCGTTAAACGGATGAGTCATCCCTGTTTGTGCTCGGCAGCTAACCAGCGAATTTACCAAGTAGCAAGAAAAGATGTCTATGTCGTTTTCACATTGAT
TCCTCTAACAAAGTTTAGGGAAATACACGTCACTCGTATCCGCAACTTGGTTGTCAACATCCTATTCTGGTAGTCGGGTATTTTGATAACTATAGAGGAA
AAGACAACACTCGAGTGAGCAAGTTCGCTAAGAGAAGCATGGGCAATGTCTGCTGCGGCGGTGGTGATGCAGAAATGTTAGAGCGGCAGGAACTATTGAA
AGAAGGCAACGACTTCAAGAAGAAAAGTGCGTTCTTAGGAGTACTCAGTAGGACAGAGAATGTCTACTTGCAACTAAACCCTGCAGCCACCAGGTACGAT
GCACAATTTGAGTGACAGAGCACGGATTCAATCACATTTGTTGTCATGACAGGTTAATGTGGCGACAGATACCTGGCCCAAGCAGTACAGAAGAATTGCC
AATTCACCGGATTGGCAAAGTTTGCCCAATAGGTATGATGACTTTCGCAGCAAGTATTTTGCTTTGGTATAACGTCTGATACATGGAATTGTTGCAGGGC
GTCTTGACTTGGTACTTCTCGGGCAGAATGGACAAAAAGTGCTGGAGTTGACAGCGTCGTCAACAAGTGTTCGGGACCTCTGGGTACAGACTTTGGAAGA
ACTTTGTCTACCAGGTCAAGGCGACCAAAGTGAAGCAGACGCCAAAAGTTTAAAGGAAAAGCTTGAGAAACAGCAGGAGAAGCAAAAGGAAGTACGTCTT
GGCAGAGGTTAATGTTTGGTTCTGTGCATATTAATCACTAACTTCATTCCTGGTTGACAGCAATACTGGAAAGATCGAACTGAGGAACTTGAGAAACGAC
GGCTTGAAGCTGAAGAGCGCAAGAAGAAAATCGGCGTTATAGGAATGAAATACACTGCTCAAGCGATGGTAAGAAGATAAACCAGATCAAACGCGGCAGC
TTTTATTTGCCGCGAACAACCATAATTATTATTTTTCACGCTAGCAGCAAGAATTACCATTTCTTGGGTACCTTGTATACCTCGTCGCCATCGTGTCTTA
ATCCATTTCAGCTCATTCATGGATGTGGAAAGAGGCAGCAAGATCGAGCATGCTCGTCGTATCCAGCGTTTTTGCATGAACCGGACCGATCGCACTGAGC
ACCGCAGCTTTGGCGACTGCACCAACTGGAATTGCAGCTTGCATTTCATCGCCAGCAAATGGTAGATATCTCAGTGCAGTCGAGAACGCACCAAGGTCGC
GAGCCAGCACCGAGATAGGTGCCCCAATAAGTTGCAATGGGACACCTCGACCCTTCTTCGTGCGGCGCCAGCCATAGATGAATCCTGGACGCAGTGCCAC
GCCCGTGCTGGGGAACCTAACAGTCCAAACATCAACAAGATAGAACCCACCCAATATCTCCGATGTCACTCACCTCGCCTGTACAGTACGTTCAGCTCGC
TCTTTCCCATGGTAGTAACCGTACATCGGCAGCCACGACGGATAGTACGAGCCTACTCGTGAATTCGAGACAAACACGAAGCGTTCCGCTCCCGCCTTCT
GCGCCGCTCGAGCTGCCAAGATCGTCGAGTCTCCGCACATCTTCTCCATGAATTCATTGTTCCCGAACGCGCCTACAGTCGAGACTGCAACAACCAACAA
AAGTCAGTACAGTTCGCACCATTACCTGTTCTACAGCGACGTACTGACGCCCGTGACGCCGTCGACGGCTTTAGCCAGCTGCTTGTCGTCAAACACGTCG
CCTTCGTGCCAGTCCACATTGTCGATCCAAGGCACGTCCTGCCACTGCGGCTTGCCCGACGGGTTGAGACTGCGCACCTCGATGCCCTTCTGCACAGCTC
GCTGCAGGATGTTGCTGCCCACGAAGCCGTTGCCGCCGATGACCAGCACACGGTGCTCGCTCTTGTCGTAGGTCTTGAGTGTGTGTATCGCGCTCTGACG
CATGCGATTCGCTGCTGCCGACAGTATCATGGAATGACGAAGGATCCGGCGCTTGAAGTGCGTCGCAGCTGGTCAATTGAAGAGTGACCAGATGAACCGA
CTCTCAAAAATAGAACACAAACGCGTATTTAGGCTCTTAAATTCTAATTCTCAGATTTTGAAACTCACCAGGATCCTGAAAGGTCGTAGATGGTTGCAAC
GGACACTTTGGCACTTTTGAATTGTGCTGCGTAGACGACAGTGAACATGGTGCGTAAAGTTTGTGCGTGTAGACTGGATGGATGTACTGACTGCTGTAGC
TTTAATTGCAGTCGAATGCCATGTCCGCCTCAGCTTTTGCACGATCCCGCGCAGCGCTGCGTCGCAAGCCCAAGCCGGTGAAAAAAGCACTGGATGAAGA
GGATTTGGAAGAGATTAAGGAGGCGTTCCACCTCTTCGATACAGACGGCAGTGGCAGCATCGACGTGCGTGAGCTGAAGGCTGCGATGCGAGCGCTTGGC
TTCCAGGTGAAGAAGGCGGAGATCCGACAGATGATCGCTGATATCGACAAGGACGAGTCGGGGACGATTAATCTGGACGAGTTCATTGAGATGATGACGG
GAAAAATGGTGCGCTGTAGCTGTTCATTTTAATGTAGACAAGAACGTTTTCATTGTGTTTGCGTATTTTTTAGAATTCAAGAGACTCACGCGAGGAGATC
ATGAAGATCTTTCAACTATTTGATGATGATAATACGGGAAAAATCTCGTTCCGAAACTTGAAGCGTGTATGCACCGAACTGGGAGAAACGCTGACGGACG
AAGAGATGCAAGAAATGATTGATGAAGCCGACCGTGATGGAGACGGCCTCATCAACGAGGAAGAATTCTTTCGAGTCATGAAGAAGCGGAGCGGCAACCC
ACTGGACGACCTAGACAGCGACGATGACTAAATGCATTTTGCACTCTTGATCGAATGCATTATCGCTTCAACAAAGCTGATACTTCAGTAGTTAAACGAG
TGCACTTCTGTCTATTAGTGATTCTGTCGTTGTTGCTACTTCACTAGGTGGCATCGAGCGTAACGCTGCCTGGATACGAGGATCTGTAATATGAGCTAAA
CGTTTTTCTAGCTTAACCGATTGCAAAATTTCTTGTACACTCCGCTTTACAACACGGGTATTTGCTAAGGATGTAGCAATAGCTGTAGATGTTAGTTTTG
CAGTGTTAGCTCCACCAGCACTTTTTGATGGTTGCAGGTCGACGATGTTGTAGCGAACTCGAACCGTAGACCCCGTGGATTCTGATTTCTGTCCTAATCG
ACTGGTAATCATAGTGGAGATTGGGGAGTCATCCGTGTTGATTTCTCGATTTTGAGATCGGTCGCTGCTATAGTCATCATCATTACCACTTTCATCGATG
CCTAGAAAGAGTTCCTCCATTTGATCACGGATAGTTCTAATCGGTTTTCGTATAGGCACGTTGATGTCGTAAAACCCGCTGGATTCTCTTAACTTGATCT
CCCCGTAGCCAAGGATACGCTTTCGCCGCCATATATCTTGAGAATACACGCTCAGGTGCAGAACTGGAGGAGCAACGATGTTGGTAAAATCACAATTCTT
GTTAGATTGTAAGGCAGTTCCTGATGATTCGGTTTGAACGAGTTTCAGATTGAAGTGCTGATGGCAGCCAAATGTAGCGGAAGATAGGCAATCAGGATAC
ATAGTTCGCCTTGGCAGTGAAAGCGGAGTCTTACAACGCTTCCGGGTATAATTGCCTGGCTGCAATTTCCACTGAAGGTACCCTGCACGGCCAGGCAGTT
CAAGCTCGTATTCCACAAAAATGAGATCCGTTGTTTTCGGGTCGTCTACCGCAACCACTTCAATCGAAATCATCATCTTTCGCTGCATGTTATTGCTGTC
AACGACCCTTGCGTCAGAAAATTTGGGGTTCTTGTAAACTTGTTGCCATCGAGTCACCTCCGCTATATCACGTTTTTCCTCTTGCAGTCGGATGTCTCGA
GAATTTTTTTGATCTTCAGCAGAAGCAAATCGAAGCAAGTCGTGTGCGTTGTCTAGCACATACTCATAGAGTGAACCCGAAGGTGTAGATACATGATACG
TGGTGAGCTTAGGTCCTTTGATGAGCAAGTCTGGGTCGTTTTCAGGCTCTACAATTGGAGCTGAAAACCCTGGTGTAGCACAGAACAATCCTGTTTCTTT
GTAAAATCGCAATGAGCAAAGAACACGCTCCACACCTTCGATGAGTGCAACGATGTGCATTGCGCGAAATTTATCTTCACGGTTAGCTCGAAGCCAGACA
CGATGCTGGTTTGATGTCCACGAGGATTCGTTTCGTTTGTGTCGTGGTCGTCGGGTGAGATCTGGTGGAATGAGGTGCGTTGTTGAGTCCTTCGACGAAC
TTGGAGGATCCTTCGCATGCTACGTTTTGTGGTCAATAAGTTAGTGGACTTTTCCCGTAAAACTTGCAAGCACACATACTTCTTCCGGAATGAAATCGTC
CACATCGACGTATGAGGACAATATGCCAGAGGTGTCATATTCGGTTGATTTTCTACCTTCACGCTAACAATTACGTGTAAAACAATTGTTAGTGACACTT
CCTTGCTCCGTGGATACTAAGTACCTTTCGATCAGAAAGTTGGATTCCTCTTGCTTCTAGACGCTCCTGCTCTCTCTTTTTTTCACTTGACCATTTTCAA
TTTCAATTACAATTAGATTAAATTTTCGTAAGTAAATACCTTGTGCATACCTCAAACTTAGTTTCTTTTCTTGCCATTTGAAGCAATACTTCCATGTTCT
CCCCACAGGCACCGAGTTGCCGCTAGAATCACTTCCAAACCCCGAAATCTACAATTCGAAATATGCAAGACGAAAATAAATAATTTCTCACCATCAATAA
TCTTCTCTACCTTGCGCAGCGTCACGCTAATGAGCAAGTTCTCCATCGGATCGCGCACATGATAGTACTGTGTCAATGGCATAGATGGTCTCTTGGTCTT
GTATTTCTTTGAGTCTGCGTCCTTTCATGGATGTATCCATGTTTGAGCTGCGTCTTTTCATGGTCCAAGCGATCAAGTTGCAGGTTCCGATGAATGAATT
TGTTGGCGATGATCAAGTTTATAGACTGAATGGTAAATCGCAATTCAGCATACGTCAGCAGATAATCTTACTGCGTTGTGCATGATGAAAAAACTAAGCC
CACACTGCGATGTTGCGCTTAGATAGCGAGTAAGTACATTGACGTGTGAATGACCTTGCAGATTGTTCTCAATCACTTCCTTCAATTTGTGTGACAATGG
AAATTGCAGAGCTATAGATAATGAAGATTCCGACTGGCTCGATCTCGGGATCGTTGATGTGGAGGTGATTGCTGCACACTGAGTTGATTGTGTTTTCATT
ACGAACTAATATACTAAAAATGATTAGGCTGAAGCAGAGTCAATGCGAAAGGAGGCCGAAGTTCGTCTACGTGTCCAGTCGAACGAAATAAAGCGGTTCC
ACGACAAAATCTGTGAACGCGTGACGGAACGAGAACGAAAAAACCGCCTTGAAGCCCAACGTTCTCAGAAATATTTGGTACCCCAGTACTTGATTGCAAG
TGTAAGAGTGTAAGTGGCAAACTGACGCGTGTTTTGCAAGTAGGACGCGAAATGTGCAAAACTCTTTTCAACTGCAGAGTCGATACCGAACACTGAAAAC
GCGTCTGTACGGAGCTCAGCTCGTCCATATTTTCAGAAATTGAAGGAGAACAAGAGAGCCTTACTAAAGGTTCGTGGGTTAAGGCATTTTGTTTCCGTGT
ATATTAGTGATCAGATGAATCTGCTCCTTGCTGACAGGATTGTCCATTGGGGAAACAAGTTGAAAAGGTAAATCGTGTGCTGGGCAGCATATCCTAATAT
TGATTAACGCATATGGGCACTAGAGCCTGCGTTTAGATGCTCAGATTCGTGAAGACTTACTGACGATCAACTGAAATCACGCGCTCACAAGTTAGAATCA
GTAGGGAATTAGCAAACAATGAAGGAGATGCATGCGATCAACTGAAATTACGCGCTCACAAGTTAGAATCAGTAGAGAATTAGCAAACAATGAAGGAGAT
GCATTAAGCGAGTCGGCCGATTCACCAGTTTTGCTTCCAGAACAGGTGAGTTATGCTTCTTACTCTTTATGTGTCAACTTCATCAACTGATTGCATTCTT
TGTACTCCAGCGTGTTGCCTTATACGCGACTGTTAGGCGCCAATACATGAAGATGCATCGAGCCAAAATCCAAAGCAATGTTTGGCGAGGTGCGCCTCAA
CTTCCCATCTCAAACAAAGCTAAGTCTCCATTGGCAAGTACATCAGTCGCAGCGGCAGTGCATGGCAGCAGAGCTCGTCGAGCTCAAAACCCAAAGCATA
ATAGCGTCGCGGAACGGGATACTTCTACTGCCAAAGTGTGCGTGAAAGATTTTTGTGGATCCATTGGAACGTATATCTAACACAACTAATGCTCTGATTA
GTATCGACATGACATCGGGTTGTGAAGTACGAGTGCATCGTCAAAACACTACATCGTCGACCCCTTGGAGAAAAAAGCGAACGAAAGTACCGCCACCTCA
AACAGCAGCAACGGAGCATGAACGATTTCTCCAGGCGCTTCAAGCACAGTTAGGAACCCCAGCTCTCTGCTCGTGTGCTAAAGCGGGACCAAGTTCGATC
TCGTCGTCACAACCGTGTGCTAACAACTGCGCGTTGTACAAGCAGCCTAAAAAGCGCGAGAAATTATTGGCCAGTGTGTACAAGCAGCAGCAGCAAGACA
TTACTACAGCTGCTGCCTCTCCAATCCGCTAGTTGCATCTTCGAAAGCATTCAATTCACTTGGTTCCTCAACTGACAATTTAAATCTACACCGTCATGAT
GACCTCGCCGTCTTCATCCTGCGCCTCGCTATCTTCATTGCCTGTCCAGATACCGTTCCACACAGTACTCCAGATGTCAGGTCCATGCTTTTCAACATAT
CGATTGAAGGTTTCTTGCTCACGTTGTGCCTTTGATGTCCAGGCATCCAGCTTCAGCGGTTGCGCTTGGGACTTCTGAGGTATGTCGTCTTCATCAAGCC
GTTTCTCGAGCTGATGCAAATCTAGAACGCTCATGTTACTGTTGGTGCTGTCTGGAGGGCCTCCTGCGACGCTGCTCGCGGTCCCATCACTAGTATGAGA
GAGAATTTCGGGGTCAGTCTCAATCTGGTACACAAAAGAAGTAGCAGTGAGAACACGCCACTCCTACTCACTATCAAGGCGTATTTCTGCAGTTGCATAC
CTGCTTGTCCACACTGGATAATTGTCGGATCTGTTCCTTCAAGCTATCCAATTGTTGTTGTTGATCCTTAATGTAGTCGTTTGCATCCTCAAGCTGCCTT
TGGACGATCGCCTTCTCGTCTCGCAGCTTGCGAACATAGTCTAACATCACGCGCTCCTCTCCTAGCATCTGAATTTCCTGTGATTCTTGCACAAGCGCTT
CAATAGTCTTTTTTAACTGGTTCACAAGCAGATCCTTCTCTTCGAGTTGTAACAACAGTTTTCCATTCTGAACTTCATGTGGACACGCTCCTGATCCTCT
TCTCGATTCACACGTCGTCCATTCATTCTGTCCAGTTTTGTCTTGTTCATTTCTTTTCTCCATTGATATCTCCTTATCAGCATCGTCACTCTCCTCCAAT
CGAGCAAATAACTCCTTCACCTCTGCGCTCGTAGACAATTCATATGCCGTCTTGTCCTCACTGAATCCCTTGACACCTTTTAAACACACATCTGCATGAT
GCAGCAACAACATCTTAGTGCATTCCACTTGGTTCGCATGGCACGCCAAGTGTAGTGGTGTAGCGCCTTCTCCATTGCGTGCATCGACTAATTTCATTTT
CTGCACGTCTCCTCTCTCCAGTAAGAACTTCATCACATCTGCCGCTTGACAAGACGCAGCCCAATGCAATAGTGATCCTCCTGTAGCGGAGTCTATGACG
CCTACATCCACACCAGCCATCAGCAATTGGTTGACACTGGTCACATCATTTGCCGCGACTTGTTGGATCAGGAACTGATGGAACACCAGGAGCATATCCT
GCGCTTTGAGTTCTTGAGCCAGAGCGTAAGCGGATCGATTTGCTTCGTCCTTGCCTTCTTGTTTCTTGCTCTGATGCTCTGGGGGGAAACCAGCAGCCAG
AAGAACTCGCAGAGCGTCCTTCTTCCCGCTTGCCACAGCCACATGAAGCGGAGAACGACCAGTTATGGGGTCCACCACATCGGCCAGTGACAGGTGCCCA
CGGCCGTGGTCAGCTAGCGCCTTGATGACGTCGGAACGGCCGTATTCGGCCGCTAGGAAGAAGCCATCCACTGCCTCCTGCAGCTCTTCGGACATTTTAG
TGATAATGGTCGTCGCCACGTCGAGTGCCACTCTAAGCGATTTGATTCGTCGAAAAGGAGTTTTTAGGCTCAAGTTCAGATGTAGCCATGTTGGTGTACG
TCAGCAACAAGATGATGCAGCGCTGGATTGAGTTGGAATAAATATGTTGATTGCATTGATGTGGTGTCTAGTTCTACTACGTTGGCGCCGTTAGGCGCGA
AGTAGGTCACGGAACCCCACCGAGAGAGCTTCGCCCCGTTTTCCTTCCACTGAAGAAAAACAAAGGCAAAAGCAGCGGAGGGAGGGGTCCAAATCAATAT
TTTAGCCTATTCACACGCAAACTTGCTGCTCCACGAGTTGAGAAAGTCGTCGACGATGCGTCGTCTGTCCACTGGTACTGTGTCGCAGTGTTTCCCATCA
CCTATAGCTTGATCATTCAAGCACGCTTACAGCTCCTTCTCCTTGGCCTCGACGTTCTTAATGAACTGGTCAAGTTGGCCGGTAGCAGCCAGGATCAGTC
CGTGGAATGGCGGTGAAGGATCGTTCGGGTGCGACTTGAACTCCGGGTGGTACTGCGTGGCGAAGTAGAACGGGTGCACGTCGCGATCAAGCTCAACCAC
CTGCATACGCTCGCCCTTCTCGTCTGTACCGACGAAGTTAAGGCCAGCCTCACGGATAGCAGGCACAAGCTCCGGATTCACCTCATAACGGTGACGGTGA
CGCTCTAGAATTGGTGTGTCCTTGCCGTACAGGTAAGACACCAGCGAGCGCTTCGCTGGGTCCTCCTTCTCGTGCACAATGGTGCGACGCTCACCGCAGC
GCATGGTTCCGCCCATGACCTCGGGGTTAATCTCGGGCATGAAGACGACCACCTTGTGTCCAGCATCAGCATCAAATTCCTCGCTGTTGGCATCCTTCCA
GCCGATGACATTACGCGCGTACTCAATCACAGCAACCTGCATACCTAGGCAGACACCCAGGTATGGAACGCGGTTCTCACGAGCGTACTTAGCAGTCAAC
ACCTTGCCGTCCACACCACGGTCACCGAAACCACCTGGCACCACAATACCATTTACACTGCGCAGCTTGTTCCAAGCCTCTTCGTAGGCCTTAGGGTTCT
TTTCACGCATCTCCACTTCCAGGTCGCTGGCTTCGATCCACTCGATCTCAAGGTCACGATCACACTTCATGGTTCCGTGCTTGAGGGCCTTGATGACACT
CAGGTACGAGTCTTGCAGACCCGTGTACTTGCCTACAAGCGCAATCTTGCAGGTCTGTTCGTACGAGTCCACGCGATGGGCCATTGCAGACCAGGCAGCA
AGATCCGGCTCGCTAAAGCGGTCCATCAGCTGCAATTTGGACATTAGGATGCTAGCAGCACCCTGTTTGGACAGTAGCAGCGGCACGTGGTAGATGTTGC
TCACGTCGTGCACCGAAAGCACGTGGTTGGCCGGAACTTGGCAGAACATGCCAATCTTGGCCTTGGTAGCGGGCTCCAACTCAGTGCTGCTACGGCAGAT
AATCACATCAGGCGACAAACCAGCGCTGCGCAGCTCCTTGATAGCATGCTGCGTCGGCTTAGTCTTCTGCTCACCCACAGAGCCGAGCACAGGCACCAGC
GACACGTGCACAAGGCAGAAGTTCTCGGGACCAACGCGGAACTGGAACTGGCGCAGAGCCTCGAGGAACACCATGCTCTCAATGTCGCCCACAGTGCCAC
CAACCTCAATGAGACAGATGTCAGCCTCTTCATCGTCCACAGCGGCAGCCTCACCAGCGTGCTTGCCGTCCACACCAATCTGAGCCACACGCTCAATCCA
GTCCTGGATGGCGTCGGTCACGTGGGGCACCACCTGCACTGTCTTGCCCAGATAGTCACCACGACGTTCCTTCTCCAGCACGTGAGTGTACACCTTGCCC
GTAGTGATATTGTGGTCGCGCGTGAGCGTGATGCCCAAGAAGCGCTCGTAGTTGCCGAGGTCCAAGTCTCCCTCTCCACCATCATTGAGCACGAACACCT
CGCCGTGTTCGAATGGGGACATGGTGCCGGCGTCGCAGTTGAGGTACGGATCAATCTTGATGGACGTGACGCGGAGACCCAGCGACTTGAGCACGACGCC
GATGCTGCTGATGGTGATGCCCTTGCCCAGGCCACTCACGGTGCCGCCGGTCACTGCCAGGTATTTCATGATGAGAGAGCGAGGTACAGACGACGGATTA
AGACTTCCGCTGCTGGCAACGAATGGCCGAATGGCCGTGCGACGTAGTGACTCGCGAAGAGCTACGGGTTGAGCCAACTGTGGCCCGCTGAGCAACTGAC
TACGATTTGTATGGGAAATGGGCCGATATAAACCCGCACGAGTGCGCAAGAGAACGGCCAGCTAAATTGGTTGGACGGCTGAAGGTGGCGGGAACGCCTT
TCGCACGGTTTTCACTTGGCGCGCACATGATTTGAGTCGAGTCAATTGCAATCTGATCGCCGGCAAATTGTATTCCTGTGTTGCAATTCCACCCTCGTCA
TGCGTGAGTTGCATGTCAAATGGCTTGCCGAGGCAATAGACTCTGATTGCTATTTTCTAGTCAACCAAGTGCAACTCCCTTGAGGTTTGAAGTAGCAGTA
TGTTAACTATCGACGATGGCGCTTCGACTTCAGTTGGTGGATAGTTGCATTGAAAAGCTCCATCGTAGCATTGGTTGGGGCATCTTGTGGGCTTGGCGGT
TCCGCCGTTGATGTTAAACCAACCTTACTTCATGTTGAACTTGGATGTTGAAGCAAAGCTGTTGCTTCGGCGATACTTGTTGTTGCTTGTTGATATGAAC
ACCAGTTCATTCTTGTTGTTGGCATGAACAAATCTGGAATCGTTTCCAAGCATTATTATCTGAGCGATCCGGTGTAAAACTATCAAAGGACGCAGCTCGA
AACGACTCCTTTGACGACACTTCCAGCCGTAGGAATAAGCTCGAGACTTCGATGGTTGTGAACGAGGCCGACGAGGCAAAGGCAAGTGCCTCACTTGATC
GTCTGCGGCTGTTCCTGTCGTCGCATGCCCCCAATGGACCAAACGAGACTCGGTCTCCATCCCCAACGCGATTGCCAACGGAGACACAGGAAGATGGTGA
TCTGGACAATTGCGGCACTTATGCAACATCGCCACCTCTGGAGCATTCTGCATGGGGAGCTGACCCCGAAGTTCTCGTGGATGACGATGAAGAGGAAGCT
GGACAAACTACCATCCCAGCTGCCGGGGCAGTGGCCAGTGTGACTCCAATGAGCCAGTCATCAAAAGAGTTCGCACGTGTCAAGTACCTGTTGCAATGCT
CATTGCCTGGGTATCGTGTGCACGAAGGTGTTGTGATCTGGGATATGCGGAACCCGTCGCTCGTGGCGCAGTATGAACAACACACAGCGGGTTTATTGGA
GCTCGAATCCTGGGTAGCTGTAAATGACCTCGGTGCCGATATGGGTGACGTGCACAGCTACGGCTTTACGTCGCTCGATGCGAATCAAACGGGCATGAAA
TTCACGACAGGTAACCTTCAACTCAGTGCACCTCTGGATTCTCCAGCTGAAGCAAAGAAGCCGTCAAGTACACGACAACTTGTACTCTGCAAAATTGCAG
TCGGGCGGTCACTTGTGATCCGTGATGAGGAAGAGGCCAAAGCACGACTTCCACCTGGATATCACAGTTACTATCTGCATCGTGATGAAGAAGTCGGCTC
TGGCGACCAGGATGAAGACCATCACAATTTGCATGCCGCGGTACTAGAACGTGGATATTATCACGAGTACATTCTGAACAATACTCTCCAAGTTTTGCCG
CAGTACCTCGTGAGGTTCACTTTTTCAGCGGCCGATGCACATGGATCTGCAGTTGGTGTATGTGCGCTTTGTGAACAGCACCCCGCTGTTGTTATCTGCC
GTAACTGCGAAGCACAGATCTGTGCATATTGCGATCAAGAAATTCACTCGGCTAACAAGTTGGTTCGTCGACACAAGCGTACACCCTTGCGAAGTAAATC
GAAAGTTCTAGTAAGCGGAGGTGCTCGGCGTGGCAGACGCCGAAGCTCCACACCCTCACTAGCTGCTGCTATTGCTGAAGTAGGTGTGGAAAACCAATTG
AACTGCCAATCTCCTAGTAGCACGGAGCCCACGGAAGCCCAGATTAATGAGATCGTTGCCAAGCAGATGGAGGAAGGTTTGTTGACGGACGACTCACAGT
CACCTACGTGCCGCACTCATCGAAGCAAGAAGGTGGAGTTTTACTGCCCTGTGTGCCAGATTCCAGTTTGTGTGAGCTGCAAAATGGTTGGAGATCACTC
GATTGGAGAGAAAGGCTCTCATCGTTTGCTTACCATAGCGGATGCCTACGAAAACTGCCTACGCGAGTCTCTGCGCCCCGACCCATTGATCACATCGCGC
AAAACAGTGATCGAAAACAAGTTGCAAGTTCTGACTCGAATCCAACGAAGTGTGCAAGAAAACAAGACACAGGTTGCGAATGCCATCAAGGAACAGTGTG
CTCGCACTCTGCGTAATTTAGACGAAGCAGTTGCAGTGAAGATGTATGTCCTATCTGGAGAAGTACTCGAATTTGAACGACAACTACAACAAATCGACTG
GGTGGATGAAAGCCTAGAAGATCACCGGACACTACTACCAGCAGTGGAGTTCTTGTCTGCCTGGAGTCAGCACAAACTGCTTCGTTCCGAGCAACGCGAC
TTCCCTCCCTTCGCACACGGCCCCAACAATTGTGCTGAGCAAGTGAAAGCAGATTTACAGCTAGGAGGTGAGCTCCGTGTCATCTGTGCAGATCAATTGG
TGACTCCACAACACCGACGTTCGCCCACTTCAGGTGACGATGACTCTGCTAGTAACGAAGACGACATCTCAAACAGCAACAATCAGGGAGGAATTGCTGA
CAGTACACAGGTGGAGCTCAAAGCGGCCGCATTACTCGTACAACACCGACGTGCAGGTGACAACGATCTACGCAAACGGCTGGTCAACATGAAAGCAGTA
CTACCGTCTACCAACGCTGGTACTTTTATGACATCTCGACGTGTCGTGTCTCCGAAGTGTCAGCAGCTATTAGATGAAGTTCGTCACGACATTATGATCC
AGAACAGCGCCAAGAAGAACCCTACTGCTGCAGGCTCACCTCACGGTGTTGGTTCGCCACGTTCTCGTTTCGGTATCCCTCTAGTGGGGCTTGCAAGTCG
AATGACCGACTCCACAGCCACGCTGCGAGCGTTCTCAGTGCAACCACACGTCAAGAATAATCTCGACGATGAATTACGTTC