Description :
From Genome Similarity Track
Location :
Scaffold_17:180087- 181802
Sequence
1715 bases(100 bases per row)
GCTCACCATGCTCATCGAGCAGAGCAGGAGGAGGCCTTGCCTCAGCTGGGCTCTTGCGGGGAGAGTCAGCACTTGCCGGAACGGCGTCTGCGTCCATACG
ACGCCGGCGTCCACGACGCGAACGTTCACCGCCCATCGGTCGATCTCGAAGAGATGATCCACCTTGTGGATAGGTTAGAGCCACCACTGTTGACTCACAA
CCAGGTCTCGGACCTTGAGCGTCCAGCTGCTCGGCTGAACGTTCAGCTTGCCTTGCTCCTGCATCTCGAGCACTTCGCTCCGCGACCTGTGGCTCTGCCA
CATGCTGTTGATCAGCCATCTGTGGATCCACCACTTGCTGTCGTTCAGCCTCCCGTGGCTCTACCACCTGCTGCCCTGCAGCTGTCCGTGGCCCAGCCAC
CGTTGGTGCCAACGCCTCCGCGCTCACCTGAGCAGGGTCTTGGTATGGCTTAAGCAAGCCGACATAGAAGACCGGATGCGTGCGCATCTTCTTCGGAAGG
TTGAGCGTATACGCTAGGCCCTTCCTGGCCACGACCTTGAACGGTCCTATGAACCGAGGTCTTAACTTCGTCTTGAAGACTGCAGACACTGCATGAGTAG
GTAGGTTTTTAGCGCTTAATAAAACTTGGTCACCGACCTCAAACCTCTCAACATTGCTTCTGCCCTTGGCATCTGCATGTTCCTTCTGCGTGTCTTGGCT
TTCAGCCATAGCGTCGCGTACTTGACGCATTACGCTCAGTCTCAAAGAGACTAAGTCATCGACTTGCTTGCGAGCCGCAACAGGGCTGACATCAGCTAGC
CGCTCGGCTATCCCTCCCCCATCAAGCCCTGAGCCACTGCGTGGCGGCGTCAGTGGGACGCGAGGGTTAACCAAGCCGTTCACATAGAACGGAGTGTAGC
CTGTCAAGGCGTGCACTGCATTATTTAATGCGAACTCAACGAGTGGGAGCATCTGGCTCCAGCGTTTTGGCGCCTCAGCGCATACGCTTCGGAGGATATC
CTCCACAACGCGATTCACGCGTTCGGTTTGACCATCGGTCTGCGGATGGTCCGCTGTGGACATGTCCAAACGAGTGCCAAGCACTCTAGAACTTCGCGGT
GAAGCGCGGGTCTCGATCCGAGACAATTGCCTCAGGCAAGCCATGTTGGCGAAAGACTCTGTCTAAAAACAGCAAAGCTGTACCTTCACCATCTATGGTG
TCCGGCACCGCCGCTAGATGAGTCATCTTGCTCAATCGGTCTACAAAGACCACTATACCTGTGTTTCCCGCCTTATCCTTGGGAAGGCCAAACACAAAGT
CCATACTCATGGACTGCCAGCATCCCTAGGGGACAGGCAAACTCGCCAATGGCGCTGCCGTGCTCGGCGCGGACTTCGTCCGTTGACACGTCTCACACGT
GCGTACATAGGTGCCGACCCACTTATACATTTTGGGCCACCAGTACATCGTGCTCACCGAGCCGTAGGTCTTCTCCCGACCTAAGTGCCCGCCCACGGGC
GTATCATGAACCTCATAGAGGATTCGATACTTGAGATCCTCATCATGAGGAACGACTACACGAGGGTTATCCTCAGAGTCGGTGCTGTAGTACAGCAGGC
CGCCATCGAGCGAGTATCGATGCAGCCTGGCGCGTAACCGCCCAGACAATTCTTTGTCAGAGTCTAGAAACTCTTCGCTCCCAAGAGCCCGTAGCAGCGC
TACGCACATGTCGTC