Description :
From Genome Similarity Track
Location :
contig_28:18007- 20739
Transcript NameFunction/comments
g6872.t1XP_009535058.1 hypothetical protein PHYSODRAFT_521707 [Phytophthora sojae

Sequence
2732 bases(100 bases per row)
CTCACGCTGCAATCGAAGTTGTTCAGCCTTCTCAAGCGCTGCTCGCTGTCGAGCGGCTGCAACCTTGCGCACAAATATCCTCAAGCTGCGACTTAGCACG
CAGAGTGCTTGGACCCACCGCCAATACATTTTGCACTGCTCAGCGCGTATGCGCCTCGCTTCAGCAATCATCCGGCGCATCTTGCGCTCCTCGGACTTGC
AACGATACCAGCGCTGTATTCGTGCTGCTGTAAGCTTCTGCCGTCGAAAGTACGCTAGAGCGCGCTCTAGTGTGGATTTTGCACTCACTCGTGCGTCAAG
TTTGCACCGCAACCAGCGAGTGATTCGTCTCACGGCAGCTCGTCGTTTTTGCTCACGACGCAGGAACGCGACAACATTGGGGTGTCTCGGAGTCAGGCCG
TCGCGAGAGGCCTCGCTGATGTGCCCACGCGCTGCAGCTAGTGCTTGTAACACTGTCAACGAGATTTCTGGGCAGTGGCGCACATCAAGACGGCATAGAC
TAGTGGCAGGGCGTATCAACGCTGCCACCCCAGTGTCTGTGAGCTGCCAGTCGTTTGACAGCACGAGAGTTTCCAGGCGCGAGCAGCACGGAGCACCACT
AATTGCTATCAGTGTGTCGTCGCGTATTTGCTCGCAGCTTTCTAGCTCAAGTACGCGCAGCTTTGGGCACCCGTGAAGAACAGCGAGGAAGCTCGTGGGC
GAAAAGTATCGAGAGCGACTGAGGCGGAGTGTGCGCAGATTGGCGCAACATGCACCGAGAGCTTCACAAAGGGCATCCGTGGCGAGAGATGTCACGTCGA
GGTCTGTCAAGAGTGAGTGAGTAGTTAACGCCGTCTTCCGAGCAAGCAGTAGCGCTGCAGCCAACCCATCCGCGTCGCACTGCGTAGTGCCAATGTGCAG
CGTTTTCAGTGAAGCTGCATCACTGCCGGTCAGCATGGCGTTGGTAGCCTCACTAAGGTGAGGGATGGAGAAAAAAGCAGCACAAGCTCCCGGAATTCCA
GCTTCGTCTTGACTACTACGCACAAGAATTCCACTCCACCGTACAGCACGCAGTTTCGGGCATCCACGAAGCAGCGCACGGATACCCGAAGAGTTTAGTC
TGCGCACTCCATCGAGCGTCACCGACTGCAGTTGTGAACACCGTGCCCCGAGCGCAGATATACCTCGACTCGTGACCTGGAAACAGCCTGTGACGTCTAC
GCTTGTCAACAGGCGACAACCACGCTCACTGGTACTTTCACCAATTTCTTCTTCAAACTCTTCTTGCTCCTCCATAGTCGGCGTCTGCCCAGTTTCGTCG
CCATTTTCGCTCTGATCTTCAGCACGAGCTGCTGATAAGGCTGCCATCTCCCCTACAAGACGCCGAATGCCGACATCAGTGATACTGGAACAAAAGGCGA
GTTGCAATGTTGCTAGATGAGGACACGCCAAGCCCAACGCGGTCAAAACTTGGTCGTCCACTAGTGAACAACGAGAGAGATCGAGTTTCGTCACGCGCGT
CAAAGCCCGCACTCGGGTCAGTCGCTCAAGAGCAGCAACTCGAAGCACAGAGCAGCCAGACATGTCCAAACTCTCAAGTCGCGACACGCAGGGACCTCGC
AGACCAAGAAACGTGAGGCCATCAACTAACGGCAATCCAGCAGCACTGAGTACGCGTATTCGGGCCGTAGCTGATGACGCTGGTAACGGAGCTCCTCCTG
GAACCGCTGCGACCGACGAGGTACCCACCAGTAATGCAAGCAGCGCTGTATCGGTGAGCTTCGTACAAAAGCTCACATCCAGATGTGTAAGAGATGAAGC
GTAGCTTTCACCGAAAGCGGCGATACCGTAGTCCGTGACGCGTCGGCAGCGAGAGAGCGATACTTGCGTTAAGACGGAGCAATGGCGAGCTAAGGTACGC
AAAAAGCGGTCGTCTACCCACTCGCAAGATGACACATCCAGCTCCGTCAGCGTTCGTGGTAGACTCGCACCTTCAAATAGTTCCCCGCCTCCACGCGATA
GCAATTGACATTGCGGCAAACGGAGAACGCGGAGTATTCCACCAGCTCCTGCAGTGGCTTCAAGCATAAGACGGAGCCCCCGAGCGGAGATGTGAGCGGT
CCCATCCACTGAGAGTGTATGAAAGGAAGACTTGGCCGGACTCCCATTCAGACCGCCCTTTACCATTGAAGACTTGTCCGGTGATGTCAATTGCAGCTGC
TGCAGCGATGCATCAGTGACGCGCCAGCCACTGAGATTCACGTGCGCATGGTACACGCGTCGACGAGGGTCGAAGAAGACAACTTCCCGCGGCAGGTGCA
ATTGTAACTTGGCCAAATTTCTCGCGTGTGCCTTGGCGCTGCTAGCTCTGTTCCCGTTGACAGCAGAAACCTTCGTCCGCGGTGCGTCTTCTTGGTTAAC
AGAGACGCGAGGTGCTGCGGGTGCGAGCGGGAGTGGCCGCGGCAACGGTCGCTTTTTCGCCCGCCGTGCGCCGTCATTCACCATTCGGCATTCGGCTCAA
GCTGCCACGGATTTGGCCGCAGTCGCTGGAAGGACGCGCTGACTCGTCAGTCTCCAAATCTTTAGACTTGGCATGAAAAGCTTGAGCGCACCGCGAACAG
TGTCTGTGCTCCTAGTCCTCGTCGCAGTACTTGGCTCCGCTTCAGCAGTGGCTGGGGTGACATCGGATTATGCAGCGCAGGTGATCGCTGCACCGGACAA
AGGGGACGAACTGGAAGAGCGCGCTTTCGTTG