Description :
From Genome Similarity Track
Location :
Scaffold_23:180064- 181745
Sequence
1681 bases(100 bases per row)
AGTTTTCGAGGGTGCCCTTTCATGTCCCGACCTCGGATCAAGAGACGGGGCAGTGGAACCCTCTCAAACTGAATATGCTTTTTTCAGGTGGTATTCTGGG
CACGCTCTAGACAGGACACATGTGAGTGCCCATCTGGCTAACCCGGTGGGATATAGGTTTTCGATGGTGCTCTTTCACGTCCAGGGGTCGGGTAAGGCCA
GATGTTATGGGAACACTGCGAAACTTTATAATTTAAAGGGAATTTTATGTTATCCAGAACCACTTTAGCCTCGTCTTTGTCGAGCTCGGTATAGGGGTAT
TTCGACCCGCTCTTTCACGTGGTTAGGTCAGATTTTATGTACAACCCGTACTTTTTATGTTACCGAGTATTTTTTATGTGACATATGTTTCAGATGCGCG
CGAACGTGAGAAAGCCGAATCTGAAAACAGATGTTGAAAATTTTAAAAATTCGAAAAGTTATTCAAAATTTTCGAAAAAAGCTAAAATTTCGCACACGTT
TTTGCCCATATCTCAAAAACGGTGCATTTTCAGCCGGAGCCACTATGCTCATTGGATTCCCCGCGCGATTTTACGTCTAGGGGGCTAGGGTTACAAGGCT
GAATCGAAAGTCGGTACTTTCGGATTTTGACATGTGAGCTATCCCAGAACCTCGAGTGATCTTGCTACTTGACATCGGTCGTCACCCCGGCCCAAAAAGT
GGTACCCGCAACACCGATTAGTCACTTCCCGTGCACGTAGCCCCGCGAAAATTGGTGAGCATATACTTCTAACTATAAATTTTCGAAAACTTGAGGGTAG
AAATGTGAGCCTCCAAAATTGAATAAAAAAATTGAGTATAAAGTTTTGAAAATCCCAAAAATTAGAAATTCTAAATTTGAAAGTCTAAATTTAGAGTTAG
GTCTCATGTCTTTGTACATTTAGGGGGTTTTCTTTGCGCTCTTTCCGATGGGCTAGGTGGCAAATCCTAGTTCCTAAAAATGAAGTCAGTATTCTAAATT
TACTACTAAGCGAAATATCACAGTAGGTATTGACATTTTTCAACATATCTTTGTACGGGCAGGTGCCTTTTTTCACGCGCTATCCGGTAGTATAAATTCC
AGGTTCGAAATTTGACATTAAATTTTTCCGAAATTTTACAATAAGGCTATGTCCCTTTTATGTCCCACCCAGGTGTCTAGTTTTTGTTCCCACGTGTGGC
CAGTCTCGTACCACACCTGGTGGTACCGGTCCGGCCTTCTTAATCGAAGTGGTTGCCGAGCTAGGGGCCCGGGAGTACAGGGAGAACGTTCTATGTACCC
TCCCTGCGTCCGTGCTCTACCCCAGGTCGATTGCCCTTTCTTGGCCAAACAAAATGCCGTATCACACTCTGACTGAGCCCAAGTCTGTGCCGAGCTATGG
CGGTCCAAAGTTGGAAGTACCGTTTTTGTTTGCTCAAATCATCCCATCTCGATCCTGAATCATTTCCCCCATCTTTCCTCTTTCTAACGGTATGCCGACC
AGGTCATAACTCGGTGCCGTTGCTGAGATATCGGGGGAAGTAGTCGTCAATGGCCCGGTTATGGGCACCATATGGCTCCAAAGCTGCCCGTTCTCGCATC
CCACTGCGTATCTAATGTGCGCACCTAGCCTAAGTCCGTCTGTGGCTGATGTGGACCACCGCTGATTGGTGTGGCGCACCG