Description :
From Genome Similarity Track
Location :
contig_47:180012- 181544
Transcript NameFunction/comments
g9203.t1hypothetical protein

Sequence
1532 bases(100 bases per row)
AAAAGAACGAAGCTCGTCGCTTCCACAGGACAACCGAGACATCCTTAGTCTGCAAACCAATGTAACGCGTTCGGCTTCTGGATCCCTGTTGTTACATAGG
AGATCCTCGACGACAAAAGTACTCACGCTGAAATTGCGTCAGAAGTCAAGTAGCATGAAGCTGCCACCAGTAGCGCAGGATGACTCAACATCGGAACCAA
GGCCACTCTCGCTTGCTAGTTCTGGCTCGAGTAGTAAGAAGTCACTAAACCGTCACCCAAAAAGCCTGAGTGCAGGGGGTAACATCAGTCCCACCGAGAA
AAGCGCAAGGGTATTGCTTTCTGCAGTGTCTCCGATCAAAGAGAACGAGGGTTTATCAAATTCAAAGGAATACCGCAGCGACTTGCGTCGCTGCGGGCGC
ATCCGAACGGAGAAGGCCGACAACATCATTAATTCCTCTAAGAATGGCCCTGTTGGAGCATCTAACGGCGCCACAGCAAACGCAGCCACGATATGGGACC
CCGTGCATGGTGTGTGTCAGCCTTTTGCCGTTTTGGGGTTCATGAAGGAGCAAACAGCTCGACCAGCGTCGAGAGGATTATCCTTGTCGTTATCGTCAGC
CAAGTTGGGCAGATCTGCGAAGTCAGCTGCCGATCATCTCCGTAAAGCTGCAGTCACTGCTGCAATCGCTTCGGGGCACACAGAGTTCACACGCTTCCGC
ATCTTTGGGAAATTCCGTGACGTTGACGATGCGCTCAACCTGTTCCGACAGATCTGCGCTGTAGAGAAGACCCCGAAATTATCAGAAGGCCAAGACTGCA
GTCGGTTCGCGGTCTACAAAGAGGACGAGATGACGATGGCACTGGAAAACTTCCCGAGTGTCGACATTAGGGACGCAGGACACAACCAGTTCAGTGCGGC
GGACCTGCCGCAAGCTACGGGCCAGCGATTCGCGTGCGTCAGCGTCTCCCTTCAGTCCACTGGAGCCTCCTGCATCGAGTCAATTGTAGTGCACGTGTAC
CAGTGTTTCCCCACTCCCCAGAGCGCCGTGAGGTTCGCTCGACAAGTGGCTGCAACACTTTTGGCTCCGAGCGCGCTGAGCATCGTGCCGTTGTTCGAGT
GGATCGCCTTGGCAGAACTGGAGCGATTCGACGCTCGCAACAACGACCTGGAGCAGGAATTGGAACTCGCTATGCGTCGCGGGGGGCAGGAGAGCACGTG
GAAGGCCAGGAAGGAGGCTCTCAAGAAAGGCGTCCGACAAAGCAAGTTGAAGTTGGCTTCAACATGATTTTTGCAGTGTAACGTAATATTCGCAATAACA
CATTTTAATTTTCTCTTCTCTTGCTAGACGCTTGCAATGGCTCCCCGTACGGCTGTGACGCTCAACATCTACGACCTGGTGGAGGCCAACGAGTTCATAG
CGCGTACGTGTGTGCGTGCGCAAGATGTCCAGCTGTGTGTTGCCTAATTATCGCCATGGGATTCCAGCGCTGGGGCTCGGCATCTTCCACAGCGGCATCG
AGATCGCAGGAGAGGAATTTTCCTACGCGAGC