Description :
From Genome Similarity Track
Location :
Scaffold_670:1800- 5710
Sequence
3910 bases(100 bases per row)
GTCTTCGTCCGCCACTTGCGTCATCTGCAGCTGATTCTCGCTCTTCTTGGCTCGCAAATAGTCGTACAGCAGACCTCCACATGACAAGTTTGATGATGGT
TCCCAAGTTATATCTTCATAGCCCACCCACTTGACTTTGAACTCGCGTACAGCACGCTCCGTGCTCGTCGTTAGTGGTGTTCTGTCGTCGAGGATGGCCT
CGACTTCATATTCACCGGCAACTTGATCTGGTTCCCAGCTGTCTTCAGGCAGTAGTTCCTCATCGAAGTCGAGTCTTGCTTCATTAGTCGCGTCAAGTAC
CAACCGAGTGTTCGGTCGACTGTTGAATTCGTTGACAGCCTTGAGTCTTGACACATGCACTACTGGGTAAAAGCGATACCCACTTCGATCAGGCAGTTCC
AGCTTGTACGCAAACTCTTCCACCTTGCGCTTGATCCGAAAAGATCCATGCCATCGGTGAGCTAATTTCTTTGTCAAGCCCGGTTTGACGCGTTCCATGT
ACAACCACGCCCGGCTCCCAATCTCAAAAAGAGATCTCGGTGGAGCTCTTGCAGGATCTTCCATCTCTCCTGAAGCTTCTAGGGGGTCCGCCGAGTGTTC
GTTTCCACTTGGTTGGGGTACAGCAGCTTTTTCCAGTCGACTCAGAGCATCATTATGCTTTTTTGCCCTTCGCTCCTTTTCTACAGCCTGATAATCTTTG
GCCATAGTGAGGGCGACCTCATGTTGTCGATTGATCTCACGCCGCCACGCCAGTGTGTCAGACTGCTTGCCGAGTCCTCGTTTGAGTGATGACGACATTG
CCCGCAACGTCGACTGCGCATCCCAACCATGAACGAGGTAAAACGGCGTTTCCTTCCTCGTAGTGTCTTGAGAAGTATTAATAGCAAATACTAGCTTCTC
CGCGATTTCGTCCCAATCTTGCTGTAGAGGGTCTTCCGCGTACACCCGTACGGACCCCATCACTGACTTCACCGAGCGTTCCTGCTGTTCATTAGCCTGT
GGCCTATAGCTCAAAGTCGCTCTTGATCTTGACTGCATCATCTCTGCGAACGCTTGCAACACCTCGCTCATGAAGCGTGGGTCGCGGTCATGCCGTATTA
ATGATGGGGCTCCGAACCGTCGGTACACACATTCTTCGAGCACTTGGGCAACACTCAGTGCAGTCGTATCTGACATAGCCTTGGCAATAACGAATCCCGT
GAACGAGCACTGAAATAGGAGCAACGCCGTGTTGCCCCTGCGAGATTTCGGTAGTGGGATCACAAAATCCATCGAGACGATCTGGAAAGGTCGTTCGGCG
AGTAAGTTGCCAGGTGAGTATCCACGAAGCTGCGGACGGCTTTTACTCGAGCTGCAATCTGGACATGACTTCACATGCTTCTCCACGTCAGCGTACAAGC
CGATCCAATAATAATCGGACTTAACGCGATGGAACGTTCTCACCACACCTTGATGTCCTCCTTCCAGCGAGTCGTGACAGTTCTGCAAGACCTCTTGAAT
CATCGTTGTCGGTACCACAAGCCGCAGCTTGGTCTCCTCTTGCCAACCGTGGTCGTACCGACGATTCGATCCAAGATAGTGAAGCACGCCGTCTTCTGAT
AACACGAACCGGTCAGCGTATTTCCAGGCATTTCGAGCTTCTTTGTAACTCAGCTCTTGTGCTTGGCCCTGAAGCACCTTCTTGATGTTAAACCACTTCT
GCTCCTCGTCTTGTGCCACCAGTATCCGTCTGCGTCGCTCCCGCTGTATCGCTACTGGGTCAACATCTTCCGCAATGGGAAATGCCGATGGTACAGTCTT
GTGAGGATGGTCTGGCAAATCTTCGCCGAATGAATCTTCGGTGGACGTCTCTCGTCGTTCTTCATGCTCCTCTTGAGCTTTTGAGACATCCTCCGAGTGT
TCATCTGCAAACCTGACGCGTTTCTTGGCTTTCGTCTGTCGCCGAGTCATCACTGCTATATTACCATAATCGCACTTTGGTGAGCTGTAATCAACCACGA
AATTTTCGAAAGTTTTCCACTTTGAAGACTCGCTGCCTGACAGTACATGTACTTGACGCTCTGCTCCTCGTGACGAAACATCTACCGAGTCTTCATCCGG
TTCGTAGATCATTTCCTGGATGCGATTCAGCGACGCCAATTCCGACTTGCGAGTTTCAGCCAAGATGACCCGACTGACTTTTGATTCCAGCGCTTCAGTG
GCTAACGAATCCGCGGCAGCGTTGTATTCTCATACAACGTGGAGATATTTAACTGATCGAAGCTTGGCCGTGCGTTCCTTGTGAGTATTCAGCAGCGCTA
GCAAAGTTTCCTTCCTGCATGCGATCACCACTAGTGATTAATGAATCGCGAGCCTTGAATCACCAACGATGACTAAATGCTCGGCACCGTGCGCAATAGC
AGCCTTGACACCGTTAATCATTCCTGTGTACTCTGTCTCATTCACCATGGTGGCCGAGAGGTAAGCGTTTGCAGCAATCACTTCCTTTCACTCAGGAAGG
CTCCACAGCACCCATGAACCACTCCCGTAGCCACCGTACTTCTCTGTCTTCGCTGATCCGTCAAAAGACATGACGAATCTGCTGTAATTACGGGGAAGCC
TGGCGTACAGCAACGCGGGGTCCATTCGAATAGTCGGAGAACCCTTGTTTGGAGGTGCCACCGGCGCGAGCGAGTCTTCCAGGTCGACGAAGCTCGTGAT
TCTTGACTGCAGTAGCTGCGCGAAGGCGACATCCTTCTCCTTCAGGTGCCACTGCGAAAGCAGTACGGCGAACTGGACCGCGCGTCCGAAGAGAGACTTC
GACTTGTGCACCCACTCTAACGTTGAGAATCGTGTATAGACATGTAGCGTCTTTCTGCCAGCTGGACGTAACAGATCTTCAACAGCAGAAGTAACGCCAA
AACTTCCTTCTCGGCAGGATGGTTGTTCATCTCGGCCTCCTTGAGCACCCGACCGAGGAACCGTACATAGTGTAACCTTCCTTCATGTTCTTGCATTAGC
GTAGTGCTCAACGCCCATTCATTCGCAAAGAGCATGACGTGAACTGTTTTCGACCGATTGAAGTGCCTGAGGATGGGTGAATGTGAAACACTCGTCTTCA
ATTTTTCGAAGGAACGACGTGCCACAGAACGGCCACCTTCACCGGCAAAGTCCTCATCCTTGAGCTGGTACAGCGCCGCACCGTAGACCGCGAAGTCTTG
AATGCAGCGACTGTAGTAATTAACCGCTCCAAGAAACGACTGCATGCCCTTCTTACTCGTTGGAAACGAAAGCTCGGTGATGGCCGCAAGCTTCTTGGGG
TCAGCCCTGATACCTTCTGGCGAAATTTTATGCGACAAAAAGTCCACCTTGGGCTGGCAGAAGATGCTCTTGGTGAAGCTAATGCTGATCCGACACTGTG
CAAATCTTGCCAGCAATCGGTCCAGCGTCGCTAGGCAGCTGTCGAAATCCTCGCCACCGAAGCAAATGTCATCCACAAACGATCGTCGACCAAACACAGG
TACCAGCGATGATTCGTCCGGTTCCCCGTTCGTAAACATGTCAGCGACGGGGCTGTTGACGAGTTGTAGTACAGGGTCGGTCTTTACCGGTGCTTCGCGG
TCTGCCGCGAACTTCGTTTGAAACGAATTCTCGGCGCTTGGCCCACGACGTTCCTTGGCCTGTTCTTCAGCTAAACGCATCCTCTCTGAGTATTCAAACC
AACCTCCTTTAGGTTGAACGAACCCCCAGAGTGCGTTGTCAATCATACGCTGGTAGATCATCGGCGCGTTCTTTAACCCAAAGGGCATGCGTAACCACTC
AAAATGTCCTAGTGCACAGACAAACGCCGATGCTTTACGTGCTCGCAAGGTCATCATGACCGCCCAGAAGCCGCTTGCTGCATCTAGCGAGCAGAACCAT
AGAACCATGT