Description :
From Genome Similarity Track
Location :
Scaffold_1488:180- 3508
Transcript NameFunction/comments
Phymu_g13341hypothetical protein PHYSODRAFT_328401

Sequence
3328 bases(100 bases per row)
AACCACTCCCCCCACACCCCGCACCTtcgtgaagacgaagttggcgacgaagccgaagatgaGGGCTCCAGATGCGGAGGAGAGTGGAGAAGTCAGGACC
TGGACCCCGGATCAGCTACAGAAGATCTTCTGtcggaagcagctcaacgcTTTCCTTCTGGAAGATCCCGTGATGATAGtgatgaagccgaagctgaTCG
GAGAACTCCAAGGCCCTGTGACCTCCCCGGTCAAAGCATCCGATCTCATGGTCGCGATCACGAGCCTGATGAACATGTTGGAAGAGGCTGGgatcgtcgc
tggagcaTTCGATGCGGAAACGTTGTTTGAGCTCACCCTGGCCACCGTTGACGAGTCGTCCAGACGCCTGTTTAAGTTCCTCAGGCCGTTGGTGGGCGCG
ACTTCGACATTATCGAGCCTTGGCCCGACGGAGGAGTACCCCACCTCTGCATCCTCGCATTCAGGATTCGCGTCTGCGAAGGCGTCTGTTGCCTCGGATG
CCGAGTCGGACGGCATGATCCAACCAGCAAGAATGACACTTGGTCCGTCCGGCGCTGCCATGCTCCAATcgaggaagatcaaggaggagaaagtgCCAGT
CAGCACTAGAGCGACGCCTAGGACGACGCCCGATCTCCACAGTCCCGATCGCATGCAAGTGTTCTTTAACACGGCCATGGAACGCTTCTTGAAAGAGCAA
GCCGTGGGGACGACCACCAGTCAGTCCAAGCCACCGACGCCAGGAATACaggacgtcgacatggaaTCAGTGGAGTCGCTGCATGGGTCCCCAGATGAAT
ACGACCCCGACGATCTGAGTATAGACGTCCCACGCCGAGCTGTAGTGGCTTCGGCGGAGACAGCTACATCGTCGTCGGAGAGCGCATCGGCAATTCCCCG
TGTCAGGATGTCAGCCATCTCTgagctgaaggagttctCTGGCAGAGACACCGACGAAGATCGTGCTCGAAGCTGGCTGGGCAAAGTAAAGTCTGCGTTC
GTCCGCGACCAGGCCCCTGATAGCGAGAAGTGCATTGTCTTCGGGAACCTGCTGGCTGGCCCTGCGCGGAACTGGTACCAGCAGCTGGGAAGATCAACCC
GTGGCAAGTGGAAAGATCTCTTGGATGGCTTCAGAGTCGAATACTGTGGGCTGGGCGTTTCCCTCGCGAGGCAGTACTACCacgcgaggaagagatcTGA
CGAGTCACCACTCGAATATCTCCACCGCCTGACCGTGTTAGGACTCCGAGCCAAGTTGCCGATCAAGACTGGACCGTCATCCGCTATCCGAGAGCATGTG
GAACATTTCATCGAGACTTTGGACGATCGTGAGCTGGCAGACCagctgacgttgctgcgcCTCGCAGATGGGGACGCGCTGGCAGACGTGCTGCGTATAC
GTCAGCGCGCGAAAGCCCGACAAGGCAAGGCGGCCGCTGGATCAACCAAGTACCGCCAGAAGACTCCATCGGCACCTCCCCAAGCTTCATCCAAGCATGC
CCGAGCTGTACGCGCGATCCGCATGACGAACGACCACGACAGTTCTGGTTCAGAGTCAGACTCCGGAGGATCGGACCTGGAACAAGGCCGATCTCAAGTC
TacctcgctgctgtcgcgGACCAATGAAAGCCGGAAGATCAACCTCAGCAACGCCGCGATCCCCAGGGACCGCCGAACAAACCGGATCAGCCCCCTCGTC
CCCGGACGGAAGAGCGAGTGGAGAAGTGTTCCCACTGCGGGTCCACGAGACACTCCGATCTCGGATGCTGGAAACGTCTGACATGTCAGAAGTGTGGGAG
AAGAGGCCACCCTGGTGATCATTGCTTGTACGTGTGTCGAGCGTGCGGTGAAGTTCACGAAGCTGGTGAATGTCCGATGGAAGAGTTTTACAACTTGATC
CGCCAGTGGTATGATCCCACGCGCCACGCCGGGATGTTTCCCTCGAAAGCGGAGAAGATGTTAAACTAGAACGCTCGCCAGGTTGGAATCTGGTACGAGC
CGAGCGTTCTAAGCTCTGCATATTTGCATACGTTGACAGGCAAGCAAACTCGAAGGTCAGTTCTCCGAAGGAACCTATCAACAATACACGTGGATTTCAA
GGAAGACGTACCTTCACGATCGCGAGCCTACGGAAAGATGAGTATGCGCGATCGGATGTTGTGATGGAACTGGATTTGGCTGATGGGAAGAACCGTGGAT
ACTGGAGAGATCATGTTCCGTACACGAAGCCGGGAGAGCTGAAGGCTGTGAACTCGCTGGCGAGGGCCACACCGGATCTCGGTTGGGAACTAAACCCGGG
TGAATCGCGAGGGTACTGGAAGTATTACTCGCCCGGCAAGTGGTTCATACAGGCGAAGATCACCGGGAAGATCAACAACTCGAAGGCCACGATGCTCTTG
GACTCTGGCGCAGAAGTCTCAATTGTGGACACCACCTTTGCTCGTAAGGTTGGCTGTGTCATAGACGAAAGTCAGAGACAAGAATGCGTAGGAATCGGGG
AGAACGTGTATACAACCTTGGGACGTACCACGATCAAGGTCACACTTGCTGGATACCTTGTGTACTTCTTCGACGCTTGGGTTGGTTCCCTGGCGGGTCA
GGATGCGATTCTGGGCATGGACTTTATGGTCCCCGCCGGGATCCGTCTGGACTTGGCCGACGGAACGATGTGTCTGGCGGATGAGGTTAGGATCCAGTTG
TCAGGCCGACGTCCGCCGTACGGCCGAAGCAGACAttcgttgttgctggaagatgaCTTGGTGATCCCCGTAGCAGGAGCTGCTACCGTTCCCCTGAAGC
CACCACGTGCGTTAGAGCGGGAGAAGTTATGGATAGTGCGTGGAGAACGATGGGTACCTACGATTGTGAAGGGGCTGGGGCGGAGACGACTCCTGCGGAT
CACCAACGTTGGTGATCAGGAACTTCGTTTGTCGCGAAGTACCGAACTGGGGATGTGGCTCGCCGAAGACCTTGTTCCTCGCGTGCCAGGTCACGTGTCA
GTCGGATCTCGTAGATATGCAGAGTGGCAGACGCTCGCATTTGAAGCGACTACCGACCGGCAAGACCAACAGGTGCCGCCCCCTGAATCGTTCGGACCGC
TAGTTGAACATCCGCGGTACGACCCCCCAACCAAGATCTTGCGAAGAGACGAAACTGCCCCCCCCCCGACCGACAGTCGCAGCTGCGACGGTCCGTTGGG
CCGAACCCATAGTGGCTGACCTCACCTTGGACCAAGAGGAACAAGCACCTGTTCCggtcgaagacgaagtcgcAGCagaaccccaagaagaaccgaAGAT
CCATGTCGAGGAAAAACCTGCTGAGATC