Description :
From Genome Similarity Track
Location :
Scaffold_1012:180- 3475
Sequence
3295 bases(100 bases per row)
TGTATCTCAATTGGTATCTCAGTTCTTTCGCGTCCAACCCGTTACCCGTGGGTGTCTCTTCCTTCCCCGCAAACAATAGCGCTGCCCACGGCCTCCCCGT
TGTCCACATGGCAGCCCTTATTTTAGTTTTGGGAGTTGACTCCGTTGACACGAGATGCCCCGCCTTGTTGAAGCCTTGCGTGTGCAGAATGTCTACCACT
GCTTGAGCGAACCCTGATTCCGCCAGTGCCTATTCTCCCAACTACCGAGGCGCTCGTCGCGATGAGCTCCGTTCTGAGGTTTGGAATGCCCagcaccccc
ccccccccctcttcAGTTCTGATATGGCTGTCTGAATCCATCCTTCGAGGGTCAAATTCAATATAAATTGCGCATGCGTTGTTCTGCATCTTTAATCATG
TCCGCCGTTGGCCAAACGTGTCTTGTCAcgtacaacaacaacggcatAATGATCGCCGACACTATTGCCATCCGTTGTTGCGCCGTGTTGAAAGTGGGCG
ATATAGTTGAAATTAAGTACCAAGGCAAAGAAAGAATACTCTTCACACCAACGGCACATCCATTGCGAAGGACATGTGGCGACGCTCACCTTTTTAGGGA
GCTATGTCTCTCTGGGATAGCGACATACTCAGAGgtggcgacgcagcagaacgaTGCGGACGTGTTGCAAGTGATGCATCAGCTAGAGGATAAACACCAT
ATCTTTGAGATGACAATGGAATCGGACCAGGGGATCAAGCACATTGAAAGTAGAGTGGACGGCAGAGAGGAGCACAGTAGCCCAAGCAGTGGCTCGATTT
CTGGTGGTTCCAGAGAAGACGGTGTCGGTGGTGCCATACCCGATTTTCACGAGGGTGATGCCGTTATGGGCAGGCAGCCAGAGGTGGACACAATCACGAA
AACGATACAAGAAGCTCATAAATAAACAGCGTGACAAGGTGGCAAAAGAAGCGGGAACCAGAATGGAGGCGCGGTGGGCAGGGCAGCACCAACATATAGC
GAAGGCGGTTGGTAAACTCAACTGGAGACGAGTGTATTGCATGGAAGGGGCTACAGTATACCAGGCGCAGAGCATTGCGAAGCTCAAGTGCCAGTGTTTA
TAAAGGGGTAGACAATGGATTCCAGAATACAAGCAGTGCATGCTGTCAACCAAAGGTACAAGGAGTGACTCAACTCATCTGGAACTGTCCAGATGCTCAA
ACGTTTTGGAAAATGATGATGATCGGGTGAAAAACATGTAAGACCGGAGAGGACCCGACAGCAACGCAACAGACGGCAGCGATTCAGAGCGTCTTCAATT
TTAAACTGGTTCACCCGCCGCGTTGGCTAGTGGACTGGAGGGGGGGGCTACATGGAGACGGTCAGTGAGAGCGGACACAAGCGGACGCAGTGGATAGTGA
CAAGGTAGCCATTGGAGAAGCATTCAAGCGCTACCGAAAAACAGAATGCGACACTATGAGTGGGGTTCTTCGACGGAGGATCTAAGGGAACCCTGGACCA
ggcggcagtggcagtgTCTGGGTAAAAATGGACCCCCATACCGGGTATATCGACCAATCTAggcggcagcaacgacattgGGAAGGACCATGACGACGAA
TAACGTCGCAGAGTTTATCGGGCTACAACGGTTACTACCTAAAACAGTCGATTCATAGTGGAGGGGGGCACACCTCGTGGGAGACAGCGCTCTCATATTA
GAAATGACGGGTCGAAGACAATTGCCAAAGGCACAAAAGCTACATCACTGGTATCGGCTCACACGAAGATTGGCAGATTTATGTGAATTGTCGAGTTGGA
CGCATCATTATAGGCGGCACAACAAGATGGCGGATTGGCTTGCTAATTACACAATGGATCAAGGCAGGAGCACCATGCTCGAATTAACAGCGGAAACGGA
AGCGCACGGCATGGAAAAAGGAGTGAAGTTACACCTGGTGGAATACATGAGGAAATGGGACGAAGAGCACGCACAAGGACGGTAAGGAAGCGAGCTAGGA
CAGGGTGGGTCGCAGGAGTGGGCAGGCCAGCGATGGACAAAGAGTGGATGGTCAACTCAGTGGGAGAACACACCTACCGATAATGGATATTAGAGTTCAA
TCCTAACAGTGATAAGTAACACAATATACCCTACCTTATTATTATTACTTATGAGTGTTACGGTAGCTATACCTCCCTTTTGAGAACAACGAAACCGTGC
CATACTTGGAACTTTACCTTAGAGGTGTTTGTTGGAGATACCGATACTGTACATTCGCCCAACAGGcaacgcctgatatatattaCTTGGCAGTACGCAT
GAGGGGAAAAAATGCAAATGTGAAGACGTAGGGAGTGAAGCGAGCAGCAAATGGCGCTATGCGGGGAATAGTGGTTTTATTTCTAGCGGTTTTTATGCTA
AAATAAAGCGATTTGATTGGGTACAGGTCCATCACCACCGTTTGTTTGTTTTTCTTGAGAAAATAAAACACTCCCCTGAGGGTGTATTATTTTAAAGCCC
GCCGGTTTTGGCCAGACTAGCAACCAGCACCCACTCGCACCCACACCAACAACTAGTCATCTCGTCGCAATGTAACTCCACCGGCTCGGTCTTGTCATCA
CCACTGCTGGCACTactgcagctgaagcggcagcaacggcatAATGAGCACCCTGAAAATGTTCTCACGCTTCACAACATCGACTTTGATGAGATGCTCG
CTCAAGACGAGTACGATGCTTGGTTTCGCAGTCACCTCCGCTGCAGCCAAGCATCTTTCCGAGCCATACATTCCATTCTTCGCAGCGTCCTATACGGCTA
CAACCTCGACGTTTACAACAAACTGCATTGATTTGGGAAGAAGGTCGCTGTGCTGATCCAATTTTTAGCGTCCGGAAAAGGCTACCGAGGCACGGACTAT
GCCCTGCTGACTCACAGCTGAATCGCCAGTAACGGCCACGCCTCGTTGACCTgcttgaacgtcttggcgcCTTCAAAACGCCCCGCCATGGTCTTGTAGC
GGAGTTCGATCAACAGGCGTAGGTCTGCATCGTCCCACGGTGCCGCGACAACTTCCGTCTTCTGTTTACGCGGGCGATCTCGCCGGCGCTGGGTGACACC
TGGTTCTTACGGGGCGTTACGTTTGGGTCTGGgtgtggtgtgtgtgtgggggggggggggcacttGTGGCTGGTTGCTTGGTGATTAAGTGACTGAGTGG
TGTTTTGATTTGGTCTCCCGAACGGTTTATCAGTTTTGACAGGGATGCAAAACTATAACCCCTAGACAGATTTCCCCACGGACAGAGCCTAACCG