Description :
From Genome Similarity Track
Location :
Scaffold_2513:180- 2147
Sequence
1967 bases(100 bases per row)
AAGGAGGGAGGATCCCGCATAGAAGGACCTGGATCCAGGGTACAGGGATGAGGGATGCAGTGGATCTCGAACCTTCGTGGGACAATGGAGATCACAGACG
GTTGCCAGATGATGTTGGATGATTGGACAGCTCAGATCCACGGCGAGTGTACAATTACAGTGAGGTGGATCCAAGCGACCTGGATCCGGATGAGTGTACC
CATAATAGGGTGACCATGATGATTACGTCATGGATCCGGTGGATCTGAAGATAACACAGCTGGGATGATGGGTCAAGGGAAGAAGGGACATGCGGCCGAG
CCTGGTAAGGGATTTGACAGGTAAAAGACATAGAAGGTAGAAATTCAGGCAGGTATTGGCTTAATTATCAATACAGACTTCTATTTGCACGATAACACGC
AAGTGCCTTCCTGCCCTCAAGAACCGGAACTACATTGGCCGTACGAGCTCGGAGAAGGTTGGGAATTGCGAACCTAGTGTTAGTAGTGATAACTGGATAA
TACATTGGCCAGATCCTACAACCTAGTGAGCTTTTCCTATACACGTGCAGATCCAACAGGTTAACTCAATTACTACTTGGTCGGTTACACCCTCGAAGAT
CTCAACTCTCAAGATCCCGTCACAGAAGGCGGCAAGTACGACGCAAAGGAACTACAAAGGCAAGGGAACACACCCGCAAGGCAACCCTACGGCCAGATCC
ACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATTCGGAACCATCCACGGACGCAGAGTGAAGATTTTTCACTGCTGCTCCACCCCATC
CCACGTCTCGTCAAGACACTCAAGCTTCACCACTTGAACTCTTTGGAAGTTACCGAGAGAGCAAGATCCCGCCCTACCGACGGGTACACAAGGTGAGGAA
AGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCCAGCAGTCTCGCAGATTTTGCTGATC
CCGCTACGCCACAATGGTGCGCGTGCCCGGATCTTTTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGGGAT
GAGGCGTCGTCGGAGGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTCCTGGGAGGAACTCTGTCGACGGAAGGGATC
GGGATCCGGATCTAGAAAAAACCTCTCTATCCTCCCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACTTGCGTCAAGATCCGCTAACAAAACAAGGGA
AAGTGAAGGCGAAACGGTGTGCATTTGCAGATTCACCGGTTAAGTCAACACCGTACCTAAACCCAACCCCGCTAGTCGAAGAAACGAGAAAGAAGACGAA
AACGAGTAAGACTACACGGAGGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCGGGTCAAGCTGGTCCGACAAGGATCTCGACTTCGTG
TATCGCCACCAAGCTTTACGCGACTTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCACGACAAATCGAAGATCCAAGGGAACCGGTGAGAGCAC
CAACGAAAACGGCGAACAAGTTGGTGGCAATCAAAGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGTGTATTCGACGCAGAGGATATCTT
CGAGCTAGATCTGGGATCTCATAGCATCCGCGACGCAGGACCTCTTTGCCAGAGCTAAGTCCATCTCCGGAGAAAGGTCGCGCACTATGGATCCAGTGTC
GTCGCCGAGGATCAGCCAAGCTGCGTCCTCGAACTACGAATCCGCCGCTGAGGAGGAGATACGTCGTCAGAGCCACGACGCATGACTTTAGGACCCTCCG
GAGCATCCATGCTGGAAGCGCGGGCGAGGGTCCGGGGCCAGGAAGCCCCTGTGAACGTGAAGGCTCG