Description :
From Genome Similarity Track
Location :
scaffold_881:180- 1681
Sequence
1501 bases(100 bases per row)
TCGCACACTGCGTCAGTTGGATTTGCGTTGGAATTAGCAGCACTTTTGTCTTGTACACAGGTCCTTCAGCGTCTCTACAGGCTGGAGCAGTGTCTGCAAT
CACCGAAGAGAGTAAGGTAAGAAGGTATGCTTGTGTTCTACTTGGTAAAAACCAGAATGAATTGATTCTTAACACGTACTGCTTGACCACAGCACGAGGA
GGAAGCCCCAGGCATAAACCCCCTTTAGACCTGAGAACCCATGGTCCCAAGTCTCCTGTCGTCCTTGACCAGACTGACAGTCCATGACACGAGCGAGAGT
TCGTCGATTCGCAGCCGAAAGGCTCATAGGAATGAGGTCAGGAATCCTGGAGTATTGACATTTCGAGAATCTACGATGCGCTACCAGCCCAACCCTCTAG
TAATAGTAGCTCTGTGCAATACACATGATGAAACGTTATTGTTGATAGAGAACTCTGGCGCAAAACCACTGCATTATTTTGAAACACGTCCGCCTTGGAT
ATAAACTCTATCCTCACTCAAAACTATGATACAGTACATGTATATCGATACCATTGAGTTGCGGCTTGGATTCGCGCTGTTGTTGTGGAGGTAAGTTCGC
AGAAATAGTATTCTAAAAAATATTTACTCGAGGGATTATTGTATAGATTTGTTATTATACATGTATACTACTGTAGTACTTATTAGTACTATTTGTTGTT
TGGTACATGTAGCAAATCACAAGTATAGTATAGTACATGCATATAATACTTAGTACTGTATTGTAATACACATGATCATGTGCTGAAAATGACGTCGCGA
ATGTCATGGATTGATGTGCCCAATCAACAAGCACTTCATTACATGGCACATGTATATTTCCTGTAGCTGTGCATGCACCCGTACATGCGCATGTACTTGT
CAAATCTAACCATGCATAGCACCCAAGAATGAAGAAGTGAGTCTTGGCATTTTTTTGTTTTGATCTTCCACGTGGGTATATGTTTGAACAGCGCTCTTTC
AAATGTCCAGGGTACTTGCAAATGACAATCCAAACTTCCTTACTCATCGTACGTGTATCTGGATACTGTACGATTCGTACATTTAACGATGACCGTTAGA
CTGTGAAAACATCATGATTGTGGAGCGAACGTCCAAACGACTGATTGGATGTGAGCGTTGTTTAGTGCACTTGAAGTCCACATGTAGATGAGCTATGAGT
CGAAGTTTGAGGCTCGAACGCAGATACAGTATACTGTAGTATGTAGTACATTGGGAGCGGCCGACGCCAAGCGGAGGGCAGCATAGGCCATCTGAAGACG
CAGAGATGACGCTATGTACAAACTTCCCGGCTGGAAGTGGAGACCGTTGGGGGATACTTTTAAAAAAAACTGTACTTGAAGTATCTTCACGTTGAAGTGA
CGTGTGCGAAAGAGCATCTATGCACAAATAGTTTTTGCTAGTTGCCAACCAGACGTACAGTGCTTCCTCAAAGTAAGACACCTCTGTACTTGAATTACCG
T