Description :
From Genome Similarity Track
Location :
Scaffold_1725:180- 1648
Transcript NameFunction/comments
Phyta_totarag13557hypothetical protein

Sequence
1468 bases(100 bases per row)
AGCTGGTTTGAATCCTAATCACCGTACTACAGAGACTACGGGGTTCTGTTCCTCGATCAGTTCGGTCACCTTTTCAGATTTCATGGACGCTTTTAACTGC
GCTTCCTTGTTTTCGAGGCGTGCGTCCCTGCCAAATTTGGCGTCAAGCGTGTCCATCATGGACCCAGTCACACCGTTGTCGTTAATTCCAATGGCTCCGC
TGTTTACCGGTAGGCCATTTTCAAGAATGTCCAGGAGCCCCACAGGAGCTTCAGAGAGTTCTGTGACTACGCCGACGATGAGGTCAATCACATCGCCAAT
TCCATCGATATCGAACTGAAAGATCAATTTTACGATCGCTTTGGCAAGGCGTAGGACAACAAGCATGAACAATAgcgaccagctccagcagacaCGTGCT
ACTCTACTGGGGTACGATTCGGTGACAATTGCATGCGTCACGTACTGCTTGATGTAAGGCGCTGCAGTGTGGATTTCgcccagcaacttgttgtcATGGT
TTTTGTTTTTGACTACAAACTCGGTCCAGTCCACTGGGTTATCGGTTCGGTTTACTGTCCGCACGAGATCTTTCATTTTCACGTCATACTCGGAGTAACA
GCCATCGTTCGCAATTGTGTTGATACAGCGCAAGACTGCGTTGACGCGCAAGTTGACTTTGGAGGCAACACGCTGCTCCCAGTCTCCTTTCTTGCGAGCA
TCTTCACCTCGACTGCACAATCGGCCGTTCTTGGCAATCACGTCACCTAGCTTGTAAGAGTCCTCCGCTCCCCAGCTGAAGATCGCGCCCGTGTACTGAA
TCCGGAGTAATTCAAACTCCTTCTGATGCGCCTTGACAATTGCCTCCTTCGACTGCTGGAGTACGACGACCACCAACTTTTGTTTTTCAACCGACTGCAA
CTTGAAAATCTCCTCCACCGCGCGCACGTCAGTCAGCCTGTGCACGAGTGTGTGCATCGTCATGCTCTTGGCCgcttccttcaccttcttcatctcctca
CTTGTAAACCCATTTCGCTGCAGCCAGTAGTAGAAACTATTGTGGGTCAGGACTGGGGCCGCTCTCTTATACAGGCAAaaagccacagcagccaTGACTG
GCATACAGAGCAGACTAATAATCGCTGCGACGATCATGAACAGGCCCTCAACGAGGTACATGacaagctgcgccacgaGAGCAAATGGTAAGCGGATATA
GTCCATGATCATGGCGCATCGAGTCGggggtggtgctggtgggcACACGCGACGGTCTTCCGTCCAATACGAAGCCCACTCGATGTTGAAGGTGACAGGA
AGCTCTTTGACAGTGCAGCCGTTGCATCCCTTAACATTTTTGAATGTGTACGTCTTCGTTGGTGCTCTGGGGTCACTTTCGCCAATTGCAACCGCAACAT
CGACCGGAGTCACGATACTCATTCCTCGACAGCTACAGGTAGTGTAGGCAAGTTTTGGTGTGCTCGGT