Description :
From Genome Similarity Track
Location :
Scaffold_3878:180- 1306
Sequence
1126 bases(100 bases per row)
CCATGCGTACATGTCATCAACGGGAAATAGGAATAGATTCTCGAACCCTTTTTGCTGTGACTTCCACTCACGCTTTGGCCCAACAAATGTCACTCTTGGT
ATACAATCACCCGATGTCCATGGTAACATGCCGCTGGACCATTCGATGGGAAGAAAATAGAATGACCAACGCTATGTTTCCCGGATACCAGTTTGAACGT
TCTCACAGGAGCTATGCATTTACTGGCAATGTCTCCCAGCTCGGGTACCCCACCTGTTCGCCCGTAGTCGTACCCTGAAGCAATACTAAGTTCCGATTTC
CGCGGGTTACCAGAACACGTTTCACACAATGGAATTGAATCAACATCGTGAACCAAGTCAGGATTCAAATGGTAAAACATCCCGTCTTTCTGATACACTT
GCAGATGTTGCCCCACAATCCAGCTCGGAAATTCATTAATAAATTCTACTTCTGAAGTCAGTAAGCGAAATCCAGGATGTAATTTGTTCAGCGACAACAG
CCGTACACGATCCTCCGCAGTATTAAGTATTTCGCAGCATGAGGCACACGCCCATAGATCGCCAGAGCTTCCTGAGCTCTTTTGAACTCGGTCTTGGCAC
GATTTCGCAATGTTAGCATCAACTGGTTCGTCGAGATTCTTCAATAAACGTTTCACGGTTGGTTCATTCCCCGATCCACATAAATTCTCGTCATTAAAAA
TACACGAGGCTGAATTGGTGTCACAGCAATGGAAATAAAGTAAGGCAAGGCGATGATGCTTTGTGAAGTGTTGGCGAAGTAAGCCTAATTCAGTGGTCGA
TAAATGTGTGACTGTCAATGCCTCTTCAATCAACGCATCTAATTCACGCACATCATTTTCATCACACTCCACACGCTCCTTCGCCCGATTAACTTCTCGT
TCCGGCAGGGAAGTGTTATTTTTGCGCTTCGAAGCTTGGCATTGAAAAGCAGCTTTGTTAACGCCACCACAGCTTACATTCGTATTCCTACATCGCAGAT
TAACATCCGGAAAGCGATGTATTTCGTCATCATTCTGAAAAATACAGCAACATAGTGATTCCGCTCACGAATGGAAGCTTCCTGGCCGACACGCCCCGCT
GTACAGTGGTAAATTACAACCGGCTC