Description :
From Genome Similarity Track
Location :
Scaffold_3880:180- 1302
Sequence
1122 bases(100 bases per row)
CCATGCGTACATGTCATCAACGGGAAGTAGGAATAGATTCTCGAACCCTTTTTGCTGTGACTTCCACTCACGCTTTGGCCCAACAAATGTCACTCTTGGT
ATACAATCACCCGATGTCCATGGTAACATGCCGCTGGACCATTCGATGGGAAGAAAATAGAATGACCAACGCTATGTTTCCCGGATACCAGTTTGAACGT
TCTCATAGGAGCTATGCATTTACTGGCAATGTCTCCCAGCTCGGGTAACCCACCAATTCGCCCGTAGTCGTGCCCTGAAGCAATATTAAGTTCCGATTTC
CGCGGGTTACCAGAACACGTTTCACACAATGGAATTGAATCAACAGCATGAACCAAGTCAGGATTCAAATGGTAAAACATCCCGTCTTTCTGATACACTT
GCAGATGTTGCTCCACAATCCAGCTCGGAAATTCATTAATAAACTCTACTTCTGAAGTCAGTAAGCGAAATCCAGGATGTAATTTGTTCAGCGACAACAG
ACGTACACGATCCTCCGCAGTATTAAGTATTTCGCAGCATGAAGCACACGCCCAGAGATCGTCAGTGCTACCTGAGCTCTTTTGAACTCGGTCTTGGTAC
GATTTCGCAATGTTAGCATCAACTGGTTCGTCAAGATTCTTCAGTAAACGTTCCACGGTTGGTTCATTCCCCGGTCCACATAAATTCTCGTCATTAAAAA
CACACGAGGCTGGATTGGTGGCACAGCAATGGAAATAAAGTAAGGCGGGGATGCTTTGTGAAGTGTTGGCGAAGTAAACCTAATTCAGCGGTCGATAAAT
GTGTGACTGTCAATGCCTCTTCAATCAACGCATCTAATTCACGCACAACATTTTCATCACACTCCACACGCTCCTTCGCCCGTTTAACTTCTCGTTCCGG
CAGGGAAGTGTTCTTTTTGCGCTTCGAAGCTTGGCATTGAAAAGCAGCTTTGTTAACGCCACCACAGCTTACATTCGTATTTCTACATCGCAGATTAACA
TCCGGAAAGCGATGTCTTTCGTCATCATTTCTGAAAAATACAGCAACATAGTGATTCCGCTCACGAATGGAAGCTTCCTGGCCGACACGCCCCGCTGTAC
AGTGGTAAATTACAACCGGCTC