Description :
From Genome Similarity Track
Location :
Scaffold_698:18- 3750
Sequence
3732 bases(100 bases per row)
CGTTTCTCAGTCTCGAACACTTCAAGACATGTTTTAATCTCTTCTGCTGTATCTACGGCATTGGAACGCTTGGTATGCCCGGCAACTTCGCTCGCGCCGG
CCCAACTTTGGCATGTTTTGCCTTGGCCTTCATGGCGTTTGCCAACACGTACTCGTCCATCACGATGTCCAAAGTCATGCTGCTAGCGCCTAGGTCCATC
AACACGTTTGGTGACCTTGGTGAATGGAGCATGCCGTTACTTGTGCGTCCTCTCTCCTTTCCTGGGGCATGGTATTTCCTGTACCCACGGGACTCTCCTG
TTAGCAGATCCATGGATCCAACATCCTCAGATCCATAGGATCCAGTGACCAGACAGACCTTAGGTGGATCTGCAGTGACTTCACCCTTGGTAGGCTCAAA
CCATCGACCATGTTGGCGTTTCTCCCAATAACCACGTGCCTCTCCTCTGTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGCAAACTCATCCATCCAC
TTGGCGCAAACTAGAGACCTTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTG
TTCACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTGACATCTTCTCGGCCACTTCTGGCAA
CATCCCTCTGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGACACTTGCCGACGTCGTGAATCTCGCCACACCCGCGA
CACACGTAGAAGCAATGATCTCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGCTTCCAACATCCAGATTCAGTGTGCTTCCGGGATCCGC
ACTGCGAACACCTGACCTGGGCTGTCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCTCGGTCGAGAGTTGTCTCC
GGTCTTCGCCGTTCGATCGTTGGGCGCAGTGAGACAGACTCGACGGTAATCGTTAGGGTCGGAGTCCGAACCGTCGGATCCTGACTCAGTTCCTGAGTCA
GGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTGGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTT
TCGCGCGATCCACCGCCCGCAGCACTTCCTCAAGCTCATCTGCGTCTGGAAGACGTAACAGGGTCAGCCTGTCGGCCAGATCCACATCTCCCAACGTCTC
GATGAAGTGATCCACGTGTTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCC
AGCGGGGATTCATCCGATCTGCGGCGAGCATGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAGCTGCGCAGCAAATCCG
GCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTTGCCCTGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGACGC
TTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGGTCCGATATGGGC
TGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCTGTTGCTACCACCGCCCGACAAAGGGGATGGGCCATCCAGATCATCTCG
GTCGAACTCATCATGGGAGTTGTCGTCCTCCACTGACTCCATCTCCACGTCTCGTGCTCCATGTTCGTGGAGCGTTTGCGCTTGTGGCGCGGGCGCTCTC
ATACCCTGTTCGGCCAGAAACCGACTCATCGCAGCTTCGAAGTGTCGCTGCAGGGTGCCCGAGGAAGTGTCGGAAGAGCCTGTGGCCGGCTGGTCCACTG
GCGAGACAGGATCCGTGAGGCGATTACCTTGGGTCCGATCTGACGATAACCCCACTGGCTTCTTTCCGGATCTGGCTCGATCCTGGCTGGATTGTATCAG
ATCACGGGTGGGGCGAACTGGATCCCGAGCCTTCACATTCACAGGGACTTCCTGTCCCCGGACCCTCGCCCGTGGTTCCAGCATGGATGTCCCGGAGGGT
CCTAAGGTCATGCGTCGCGGCTCGGAAGACGTATCTGACCCATCCTCAGACGCGGATTCGTAGTTGGAGGATGCATTTGGCTGATCCTCGGCGACGACAC
TATATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGGTCCAGGTCTAGCTCGAAGATA
TCCTCTGCGTCGAACACACCAGCTACGATGCCTAGTCCGTAAGCAAACGTAATAGATCCTTGACTGCCACCAACTTGTTCGCCGTTTTCTTTGGTGCTCT
CACCGGTTTCCTTGGATCGTGGATTCAGGATCTGCATGACTGGATCTTGATGCAGGAAGTCGCGTAAAGTTTGGTGGCGATACACAAACTCGAGATCCTT
GTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTCGTT
TCTTCGACTAACGGGCTTGGGTTTAGGTACGGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCT
GACCTTGACTTGCATCAAGATCCGCAGGGGTACCTGGGGAGGATAGAGAGGTTTCTCTTCTGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTC
CCAAAACTCCATCGATCCGCGGATCTTGTTCCATTCAGCAGCGTCTTCGTCGATCCGACCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAG
CATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCTG
GATCCAACTTACCAACTGCACCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTA
GGGCGGGATCTTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGCGTCTTGGCGAGACGTGGGGATGGGGTGAAGCAGCAGTGGAAAA
TCTTCACTCTGCGTCCGTGGATGGTTCCGAATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTTGCCTTGC
GGGTGTGTCCCTTGCCTTTGCGTTTCCTTTACGTCGTACTTGCCGCCTCCTGTGACGGGATATTGAGAGTTGAGACCTTCTAGGGTGTTACCAACCAAGT
AGTAAATTCGGTTAGCCTGTCGGATCTGCACAAGTAAAGGAAAAGCTCACTAGGTTGTAGGATCTGGCCAATGTATTATCCAGTTATCACTACCAACACT
AGATTCGCAATTCCTAACCTTTTTCTAGCTCGTACGGCCAATGTAGTTCCGGTTCTTGAGAGCAGGAAGGCACTTGCGAGTTACTGTGCAAATTGAAGAC
TGTATTGATATTTAAGCCTATACCTGCCTGGA