Description :
From Genome Similarity Track
Location :
Scaffold_3583:18- 2506
Sequence
2488 bases(100 bases per row)
ACTACGGGGGCCGGTGGAAGAAAGAAGATACTCGCGCTCCTGCGCGTGGTTGGATCTGAAATTACAACCCTGCTAGTGGGAAGATCCATCCCGGATCGTG
ACTCGACACTCTACGCTAGCCTGGGCTGTTCAAGTCGGCCGGGTTACAAGGAACAGTGGGGCAGCTTTACTCTCGCCTTGGACGCTGGAGATTGTGAAAT
GTTCGAAAGGGGAAGACGAGATCCTGGGAGTCTTGGCCGCGAGCATTACTCCTCGAGCTAAGCTGGATGAGGCGCTGACTAGAATCGCTCCTAAGAAAGA
GCCCAAACGCCGGATCCAGATCCCGATCCCGACGGTACAGGTGGATGAGGATCTGTACGTCCTGAGTTTCGATGGATCCGCTCGTGTACGACGCGGAGGA
GGAGCATACAGTGCAATACTGTGGAAACTACCTGAATGAGAAAGTGTTACGGGCCGAATACCACTTACGCGGAAGCCCTCCCCCCTTCAATGATGCGGAG
TATAACGGCCTCCTCCTGGTGTGTTGTGATTTAATGAGAGAACAAGATCCAAAACGGCTGGTGATTTGTGGGGATTCAAATTTGGTAATCACACACGTGC
GAGGTGAGATTGACTGCAAGGCCCCGGCCCTAACACTGTTACGGCAGAAAGTGATGATCCACCTGCGCGGTTGGATGAATCACGAGTTGGTGCATGTCAA
GTGAGATTGGAATGCCAGTGCAGATAGCTTGGCCAGCGCCGCTTTACGGAATCAATGTGGTGTTGAAGTGGAGAGAGAGGCCGAGCATCAGGATCTCGTT
ACGTTGAACCGACTAGACGAAGTGGTGGTAGTGGGGTCCGGGAAAAGGACAGTCCAGGTGATGGCCGTCACTAGGTCCAGAGGAAGGATTGGATCCAACC
CCCCAATTCTCGAGGAAACATTTGTGAAGAGAGTCCGCATCGAGCGGATCCTCAAAGCACAGAACGAGGAAGCGTGGATCCTAGGACTAAAGAAGTATCT
GATGGGGGATGTACGAGACCTGAGTCGGGAAGATTCCAAATCCTACAGCATTATCGCTACGGATTACGCGGTGGATCTGAATGACTTGCTCTTCTATTGC
CCCCCCCTACGAAGAGAGTCAACGAGAATCGGGATGAATTGATGAGACTAGTGATGCCGGAAACCTTACAACAGGATGTCCTACACCACTATCACGCTAG
CTTGGAAGGCGGACATCAGGGTATTGGTCGGACCTACCAACGGATCCGGGAATGTTTTCACTGGAGGGGACTATTCAAGAGCGTACAACGGTATGTCGGG
GAATGTGTGGATTGTGAGACAGGCAAGGTCAGGCCCACAATCGAAGGGGAGTCACCTGGGAATATCCAAGCGACTTACCCTTTTTAAATCATAGCCATGT
ATCATATCCCCTCGTTGCCCAAGTCGTTCAAAGGAAACACAGAATTGTTGATTTGGGGGACCTGTTTCCGGATACGTGGTACCAAACTATGCGTCTGAAT
GCGCGACCTTGCGAATCTTGCGAGAGAGGGTCCTTTTTGGCGAAAATATGGGGGAAATACAAGGGCAGAATGTTTTTAGAAAACATGATTGCGGAGACCG
AGCATTATTTTTGTTTTTCTTTCGAGCATTTCAACCACCTTTCAACCAAGCTAACGGGTCGGCCAAGCGCATGGTACAGACGATCGCGAGAGCACTCAAG
ATGTACGTCCAGGATTTGGATCAGAGGGATTGGGATGAGTACGCAGAACGGCTCCCCTTCGCGATGAACACCGCCCAAGACAGGATCCGGGGTGATACCG
CATTTTACTTGGTACATGGGTGGGATCCCAAATCCACCCTGGAAGCGGCCATCCCAGTATGCAGCACCAAGAAGAGAAACCGAGATCCAAGACGATGGCG
ATACCAAGTCCAGAAATACTACCGGCAAGCTAGATCCCAGGTGAACGAACGACTGCGGAGTGCAATACAGGATCGAGCGGATGGACACAACGAAGACGCC
CGTCCACATCAAATCCAAGTGGGATCGCAGGTGTGGCTTTATTTAGATCGAGTAAAAGAAGGGTACGCCCGCAAATTGGCCCATCTATGGCATGGGCCGT
TCCGGGTGAGCAAAAAGATAGGGGAACATGCGGTAAAGCTGGAAACGACAGGTACCGAATATCGCTTGTTCCCTGTAGTACACGTATCCAAGCTGAAGTT
GGTCAGGGAATATCCGGATCGGCCGCAAACCCGTCTTTCGGTGGATAGATCCGACCGGGTGGATTTCGACGAAGTCCTCCTACCGGAAGATAGTTGGAAT
GTGGATCTCGAGGCCGACGAGTTCGAAGTCGAGAAGATCACCGACATGAGGTCAGGGAAACGAACTAGATACGGACGGATTTACCGTGAATTTTTGGTGT
ATTGGCGTGGATATGACGAACCCAGTTGGGTAGACGAGGCAGATCTGAACTGTGGAGCATTACTCTATGATTCTTGCGGATCGTACGA