Description :
From Genome Similarity Track
Location :
Scaffold_2878:18- 2448
Transcript NameFunction/comments
Phypl_g15458hypothetical protein

Sequence
2430 bases(100 bases per row)
TCCTCCTCGGTGTTCCCAGCTTCAGTCGTAGCTTCCAACGCCAGATTCTGCCACTCCATGTAGCGGCGAGATCCGACCGAGACAAAGCCGGAAAGTCGCG
GGACGCGATCGCCGGCCAGCCATATCGCGATCCGCTCATCGCCTTGCAATatcagcttcttctcacCGAGGTTGGTGATCTGGAGGTAGCGTGTCTTGCC
TTGCCCCTTGATCACGCTTGACACCTAGCGGTCTCCACGCGTGACCCACAACTTCTCGTGATCCGACGTGCGCATGCGTAATGAGAGTTCCACGTACTTC
CCGATCCCGATCTGTAAGTACTGATCTGCTCTCAAGAGTTTCACCTTATCACTgtggagctgtcggcgaCCGCTGAGCTGGATCTTCACTTCATCGGGCA
GGCAGATAGATCCATCGGCCAGGTCTAGTCGGATCCCGGCCGGGACCATGAAGTCCATACCCAAGATGGCTTCTTAGCCGGACAGATCGCCCACCCATAT
GTCGAAGAAATACACCAGTGATCCAGCTAACGTAACCTTGATCTGAGTCCTTCCTTCCGTCCTATACACGTTCTCACCAATTCCAACACATTCTTGACTC
TGACTTCTGTCTACATAGCACTCAACCTTACGAGCAAAGGTGGTGTCCAAAATGGACACCTCGGCACCAGTATCCAGAAGCAAGATCGCCTTCTTATTGT
TGATCTTGCCAGTGATCTTGGCCTGTCGAAACCATTTTCCAGGTACGTGATGTTTCCAGTATCCTCGATATTCTCCAGGGAGACGTCCCGCAGACTCCAC
GACACCAGATCTGCGATATTCATCGACACGGGGTTTTTGACGGGTAGCAGCGATTTCACCTTTGTCAGGTACAAACCACTGATCTGGATCCTGTTGTTTC
CAGTATCCCCTTGGCTCTCCAGGGTGGAGATCCAGGGATACGGAGACATCAAATCTGACGTACTCATCTACTTGGCGTAGATTCGCAACTCCTACTGTAC
ATTTCTCACGCAGATCACATGTATTACAGTGTAGATCTTGTCGCTTGCTAGCTTGATCTACCGATTTCTTGTTCACGAATGCATAAATGCAATACCTAGA
ACGCTCGGCTCGTAACGGATTTCAACCCGTCGAGCGTCCTAGTTTAACATATTCTCGGCCATCGTAGTCAACATGCCTGCGTGCTTCGTCGGGTTGTACC
ACTGACGGATCTGGTTGTAGAATTCTTCCATCGGGCACTTGCCCATGCCGTGAAGTTCTCCACATCCTCGGCACACGAAAAGGCAGTAATCAGCTGGATG
GTCTCGCTTTCCGCACTTCTGACATGTCAGACGCCTCCAGTAATCGCGATCCGTGTGCTTGCGAGATCCACAGTGCGAACAGCGACTGCGGTCTGATCCG
TCACCGTAGTCTCGAGATCTACGGTCTCAAGGCGCTTGATCTGAGTTCCGTCGGTTCTCTTGGCTCGGGTTTGGAGAACCCCCGCCAGCCTCTGGTTCTT
GCGTATGCTCGTTGTCAGCGGCTAAGTAGATCTGACGGTAATCACCGTCCTCTGAGCCAGATCCGCTTGATCCAGAGTCCGATCTGGCTTCGGGGATCGG
GGCCTGGATCGCGCGAACACGTTTGGCTGGGGCTGCCGGTACAGGGGTCGATGCTTTCTGACGATTCTTGCTAGATCCGAACGCGGACTTCTTCTGGTGG
TTCTTGGCGCGTTCGAGTGCGCGGAGGACTTCTTCAAGTTCGTCAGCATCCGGCAGGCGTAGCAGCGTCAGTCGATCTGCCAGATCATGGTCATTCACCG
CCTCGGTGAAATGATCGACATGCTCGCGCTTGTCCTTTGGTCCGCCATCCTTGATCTTCAGCCTTGCGCGTAATCCGGCGACATTAAGTCGGTAGAGATA
TTCCAACGAGGTTCGTCGGATCTCTTACGCGCGTGGTAATACTGTCTCGCGACAGAGACATCAAGACCGCAGTATTGGATCTGGAAACTACGCAACAGGT
CAGACCATTTGTTTCGCGTAGATCTGCTGAGCTGGCGATACCAGTTCCTGGCAGGCCCTGATAGTAGATCAGCGAATATCAAACACTTCTCTTCGTCTGA
AGCCTGATCTCTCATGAGCGCTGACTTGACCTTGCCGATCCAGGCTCTGGCGCGATCTTCGTCCTGATTTTTCCCCGTGAACTCCTTGAGATCTGAGATC
GCGGAGATACGGACACGTTAGATCATAGAGGAACTCGCTGATCCTGCAGTGGCCGTTGCTACTGCAACTCGGGTGGTAGTCGGGAAACCTAGATCATCCG
GATCGTACTCCCAGTGAGTTGCGTCCCGTACTGGTGATCCCGCCGactccatctcgacgtcTTGTGATCCACGATCTTGAGGCGTCTTGGTTGCAGGTAg
gactgctgccacttgttGTTCCAACAGGAA