Description :
From Genome Similarity Track
Location :
Scaffold_3747:18- 2140
Sequence
2122 bases(100 bases per row)
GAAGTAGATCCATTTGAGGGCAGGAGAGCCAGGGGATAACTGGAACCCCGTCCCGTGTAAGACGCAGATCTTACATCGACGACATTCTAATCCCGGCGGA
AATCGTGGGATCAGTTATGCGAAAGAGTGACATCCCTGCTGAAAGCGTGTACTAAGTGGAATCTCTCTATCCGTGTGGTAAAGAGCTATTGGGGGATGCG
CAAGGTGGATTACTTAGGCCATCGAGTTTCAAAGGAGGGATTGGAGGCGAATCTAAGGACCTATCTCGTTAGCCGATCTGTCTTCCCACAGTCGTACGGG
CGATGCATCCTTCTGTGCAGTTTAAATTATTACATGCGTACTTGCGAGTATTAGCCACCGTTGGTGGGCGTTACTTATAGGAGAGGGAGAGAGTGATTTT
TTGTGGGACATGAACCATTCCCAGCTTTGCGCGATAAAATATCCAAACAAGTCTCGGTCCGCGGAGATGTTACATTTCCGCGAGAGATTCCCAGGTGGTT
AGCGACCCCAGAGAGAGGGAACTGAAAACAGGGAGCTGGATTCCCCCCCGCGGGCCCCCCGCGGGGAGAGAGGGTTCCTTTCGGGATAGAGACGACGGAT
CAGAACATGGAAAAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGAGGAACAGGATCGCGACCACGCCTATCCTCCGTCATTTCG
ATCCAGAACGTCAACCTACGGTAATAATTTATGCCAGCGACTGGGCAGTCTCAGCAGCTCTGGTACAAGAACATGAGGGGATCTGTCATCCAGTCACCTT
CGTCAGCCGGACACTGAAGCCGAATGAACTGAACTACGGAGCGATGGAGAAAGAGATACTCGCGCTCCTGCGCGTGTTGGATCTGAATTACAACCTGCTG
GTGGGAAGATCATCCGGATCCTGACTAGACATTCTACGTTAGCTTGGCTGTTCAAGTCGGCCGGGTTACAAGAACGTCTGGGACAGTGGGCAGTCTTACG
CTCGCCTTGGACACTGGAGATCATGAAATGTTCGAAAGGGGAAGACGAGATCCTGGGAGTCTTGGCCGCGAGCATCACACCTCGAGCTAAGATGGATGAA
GCGCTGACTAGGATCGCTCCTAAGAAAAAGCCCAAACGCCGGATCCAAACCCCGATCCCGACGGTACAAGTGGATGAGGATATGTACGTACTTAGTTTCG
ATGGATCCGCTCGCGTACGACGCGGAGGAGGAGCATACAGCGCAATACTGTGGAGACTGCCCGGATGGGAAGTTGTACAGGCCAGTTCCACTTATGCAGA
GGGCCTCACCGTCAATGAAGCACGGTATAACGGGCTCCTGCTGGGTTTGGATCTACTAAAGGGACAGGATTCAAAAAGGCTGGTGATTTGTGGACATTCA
AACTTGGTGATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCCTAACACTGTTACGGCAGAAAGTGATGATCCACCTGCGTGGTTGGATGAA
TCACGAGTTGGTACATGTCAAGCGAGATTGGAATGCCAGTGCAGATAGCTTGGCCAGTGCCAGTTTACGGAATCAATGTGGTGTCGAGGTGGAGAGAGAG
GCCGGGCATCAGGATCTCGTCACGCTGAACCGACTAGACGAGGTGGTGGTGGTTGGATCCGAAAAAAGGACAGTCCGGGTAATGGCCGTCACTGGATCCA
GAGGAAGGATTGGATCCAGCCCCCAGAGTCTCGACGAAGCCTTTGTGAAGGGAGTCCGCTTTGCGCGGATCCTCAAAGCACAGAACAAAGAAGTGTGGAT
CGTGGGACTAAAGAAGTATCTGATGGGGGAATATACGAGACCTGATTCGGGAGGATACCAAATCCTACAGTATTATGCAGTGGATCTGAATGATTTGCTC
TTCTATTGTCCCCCTACGAAGAGAGTCAACGAGGATCGGGATGGATTGATGCGACTGGTGATGCCGGAAACCTTACAACAGGATGTCCTACATCACTATC
ACGCTAGTTTAGAAGGTGGACATCAGGGAATCGGTCGAACCTACCAACGGATCCGGGAATGTTTCCACTGGAGGGGACTATTCAAGAGTGTGCAACGATA
CGTCGGTGAATGCGTGGATTGT