Description :
From Genome Similarity Track
Location :
Scaffold_2924:18- 2135
Sequence
2117 bases(100 bases per row)
CAAGAGCCAATTACTGGACCACTATGAGGAGATGGGCGATGATTGGCGAAGGGTGGTATCCCTAGGCGACCTGGATATGTGTCAGTGGGATCTCGTCCCT
ATAGAAAATGGCAGAATCTAACGTATGACGCGACTACCGAGATCGAATCTCTCGGGGAGGTGTAATTCCCGGCGGGGCCAACTGGTCCCTTGGTGGATCG
GCCTTCATACCCAACTCCGCGAAAGATCCTACAGAGGGATCGTCGGATTGGGATCCAAGTGGTAGAGATTGGGTCCAAGACCGGGGATGATACCCAGAGC
CGGTCCCTAGATAACCCAGGGTCGGTGGATGGGGGATCGCAGATAATTGAAGCCGGGTCGCCAGATCCCGCTAACCCCCGAGTGGATCCTAGCTTTTCAT
GGGACAAAGTGTCTGGAACCTTATCGAGAGTGGCAACACTAGTCAAACAAGAACCGTCGTGTTTAAACTCGCTAGATGATCAAGTCGATCCAACTGGTGG
CTTCCCCGGTACCAGGGTACCTGACCCCACGAAGACAGAAGGACTGACAGGTGAAAGAGGGTCGCGGTGCTTGAAACCACTGGTGGATCGGACAAAGACT
GAAGATGAGCAAGTCTGCTACCGTGAAGGCGGGGATCTACACGCCGAGGATCTTGGAGAAGGCATGGCGGTGATCCCGGAGGTACCACTGACCACAGAGG
AGGTCACGATTGATGATATCCAAGTGGATCCAGGGGCGAACGAACCCGCTGAAGTGGATCGTCTGCGTCAGAAGATCTGGGAAAGCCGACATCTGCTGAT
TGGTAAAGGTAATGCGCTACCGCCAGCTGCCCGCGGAGTCTAATGTGACGTCGATGTCGGCGACGCGAAACCGATCGCTCAAAGGGTGCGGAAGGTGGCA
CCTCGATTCCGAGAAAACTATCTGATCTGATTAAGGGCCTCCTGCAAGCCAAGATCATCAGTTTCTCAACGTCCCTGTGGGCATCTCCAGTGGTAATCAT
CATCAAGAAGAACGGGGTGGATATACGTCTTTGCATTGATTACCGGCTGGTTAACGGCCTGACTTGACTGATGGTGTATCCGATGCCTCTAATCAATGAG
CTGTTGGAAGATTTGGATAAAGTACTCTGGTACTGCTCTCTTGACATTGCCAGCGGTTTTCGGGTACTTACTATGACGGATCGAGCTCGCGCGATATCCG
CATTCATCACACCGTTTGGCCTGTTCGAGTGGACCCGGATGCCGTTTGGATTGAAGAGCGCACCCCAGATCTACCAACGCCTAATCGATAACGCCCTCTA
TGGGTTCACCCGAATACCGGAGCCCGAAACGGGTGGATCCGGGGAAGGCAATACGGAAGTGGATCCATTCGAAGCGGGGGAGCCAGGGGATCCTGGGACC
CCGTCTGTGTTAGGACGCAGATCTTACATCGACGACATTCTAATTCCGGCGGAATCGTGGGATCAGTTGTGTGAAAGAGTGACATCCCTACTGGAGGCGT
GTACTAAGTGGAATCTCTCTATTAGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTGGATTACTTAGGCCATCGAGTTTCCAAGGAGGGATTGGAGGC
GAATCCTAAGGACCTGTCTTCGTTAGCCGATTTGTCCTTCCCGCAGTCGCTACGGGCGATGCAATCCTTCTTGGGCAGTTTGAACTACTACAGTCGGTTC
ATCGAGGATTACGCCCTGTTTGCCGCGGTATTGTATGAATTGAGAGAGGTAGATTTTGCTGCGATGACCACTCCAGCTGTCCGGATAAAAATGCAACAAG
CTCTGGCCCGGGAGATGTCGGATCCACGAAGAAATCCAAGTGGTACGACACCAGAAGAGGACCTAAAACAGGAGCTGGATCCACCCCGGGACCAACGGAG
AGAGGATCCAGTCTGGATAGAGACGACGGATCAGAACATGGAAAAGGCAGAATATCGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGAGGAACAGG
ATCGCGACCACACCTATCCTCCGTCATTTCGATCCGGAACGTCAACCTACGGTGATAGTTTATGCCAGTGACTGGGCAGTCTCAGCAGCTTTGGTACAAG
AACATGAGGGAATCTGT