Description :
From Genome Similarity Track
Location :
Scaffold_3346:18- 1854
Sequence
1836 bases(100 bases per row)
AAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCAAGCTGGTCCGACAAGGATCTCGAGTTTGTGTATCGCC
ACCTTGCTTTACGCGACTTCCTGCATCAAGCACCTGCCATGCAGATCCTGAATCCACGACAGATCGAAGATCCAAGGGAACCGGTGAGAGCACCAACGAA
ACGGCGAACAAGTTGGTGGCAGTCAAAGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCAGAGGATTTCTTCGAGCTAG
ACCTGGATCTCATAGTATCCGCGACGCGGGACCTCTTTGCCAGAGTAAAGTCTATCACCGGAGAAAGGTCGCGCACTATGGATCCAGTGTCGTCGCCGAG
GATCAGCCAAGCTGCGTCCTCGAACTACGAATCCGCCGCTGAGGATGAGTCAGACACGTCGTCCGAACCACGACGCATGACTTTAGGACCCTCCGGGGCA
TCCATGCTGGAAGCGCGGGCGAGGATCCGGGGACAGGAAGTCCCTGTGAACGTGAAGGCTCGGGATCCAGTACGCCCTACCCGTGATCTGATATAATCCA
GCCAGGATCGAGCCAGATCCGGCAAGAAGCCAGTGGGTTTATCGTCAGATCGGGCTCAAGGTAATCGCCCCACGGATCCTGACTCGCCAGTGGACCAGAC
GGCCACGGGCTCTTCCGACACTTCCTCGGGCACCCTGCAGCGACACTTCGAAGCTGCGATGAGTCGTTTCCTGGCCGAACAGGGTATGAGAGCACCCGTG
CCACAAGCGCAAGTGCCCCACGAACATGGAGCACGAGCCGTGCAGATGGAGACAGTGGAGGGAGACAACTCCCATGATGAGTTCGACCCAGATGATCTGG
ATGGCCCATCCCCTTCATCAGCGGTGGTAGCAACAGCCGCAGCCGGGGCGGGTGGATCGTCCATGATCCAGAGGGTACGGATCTCAGCCATATGGGATCT
GAAGGAGTTCACGGGCAAGGATCAAGACGAGGATCGAGCGAGAACATGGATCAGCAAGGTCAAGTCGGCCCTCATGAGAGATCAAGCGTCGGATGCCGAG
AAGTGTCTGACCTTTGCGGATCTGCTAGCGGGGCCAGCCAGGAATTTGTATCGGCAGCTGGGTAGATCCACCAGGAACAAGTGGCCAGATTTGCTGCGAA
GTTTCCAGACCCAGTACTGTGGATTGGGAGTGTCGGTGGCACGACAATACTACCATGCTCGCCGCAGATCGGATGAATCCCCGCTAGAATACCTACATCG
ACTAAATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAGGATGGGGGATCCAAGGTACTGCGGGAACACGTGGATCATTTCATCGAGACGGTGGGAGAC
GTGGATCTGGCCGACAGGCTGACCCTGTTACGACTTCCCGACGCAGACGAGCTTGAGGAAGTGCTGCGGGCGGTGGATCGCGCGAAACACCGCCAGAAGA
AGGCGGCGGTCGGATCCGGCAAGTATCGCCAAAAGGCTCCGACGCCTACGGCCCCAGCTCGACGTGTCCACCAAGTCACGGCGCCCGACTCAGGAACTGA
ATCAGGATCCGACGGTTCGGACTCCGACCCTGACGATTACCGTCGGGTTTGTCTCACTGCATCCAACGATCGAACGGCGAAGACAGGAGACAACTCTCGA
CCGGGGGATACCGTACCCGGGGACCGTGGGATGTACAGATCCCGAGATCTCATGGACGGGGCAGCACAAGTCAGGTGTTCACAGTGCGGATCCCGGAAGC
ACACTGAATCTGGATGCTGGAAACATCTGGTCTGTG