Description :
From Genome Similarity Track
Location :
Scaffold_541:18- 1784
Sequence
1766 bases(100 bases per row)
CCAAACGGACTGTGGGAGTATCTTGTACTTCCGATGGGAGTCTGCAACGCGCCAGCAACAATGCACCGGTTGACTTCGAAGCTGTTCCGAGACTTGAAGA
ACACGAAGTCGTTCTACGATGACATCTACATCTTCATCAAGTCACCGAAGATCGAAAACCATTTGGAGGCGCTGCACGGACGTTGGATATCTTGCGCGAC
AACAAGCTGTACGTCAAACTGTCCAAGTGTGTCTTCTGCACCGACGAGATTCCATGCCTTGGTGATTTCGTGGGACGTAACGGAGTTCGGATGGACACCG
ACAAGGTGCAGACCATCAAAGACTGGCCCGTGCCGCGGACCCAAGAGGAGCTTCACAGCTTCCTGGGTCTGACTGGCTACGTGCAACGCTTTTGCCCGAA
ATACGCTTCGGTCACGGCAACCATGTTCGCCCTCCTGAAGAAGAAGATCAAGCGCAACGCGAAGCTTCACTTCAGCGACGTGCAGTTGAGGAATTTTAAG
GAGTTGAAGCGGAGGTTGTGTAACCCACCAGTGCTGCATCTCCCGGACTTCAGCCAGCCAATGCATCTGCGGACGGACGCGAGCAAGTTCGCCGTAGGTG
GAGTGCTGTTTCAAGTCGTCGATGGTGTCGAGCGTCCCATTGCGTACACCAGTCGGAAGATGAAGTCTGCGGAGCTCAACTACCCAACGCAACAACAGGA
GTTGTTAGCCATCGTTCATGCACTGGCCGCGTTTCGGATCTACTGCTTGGACAAGCCGCCAATTGTGGAGACCGACCACAAGAGTGTTCACACAGAAGAT
GGCCAACCACCGACTAGCACGCTGGTATGATATCCTTGCGGAGTATCAACCGACGTTCTCGTATCTCCCTGGAGCGAAAGACGGTATTGCAGACGCTTTG
AGCCGAAGACCAGACCTGGAACCGGAGACGAAGTTCTTCCACGACTTGAGTGTGACAAACTTCGACGATACATCCTTCAGTCTGGCTATCAGCGAAGTAA
CTGGCGACTCCGACTTGATATCAAGCATCAAGAAGTCGTATGAGAAAGGCCGCGAGGTCCAGGCCATTTTCACAGCGATCAAGCGGCGCAACTCCAGCTC
GAAACCGAAGCGTGAACGCAACCAGCAGAAGAAGTACCGATGCTACACCGAAGCGTATGGACTGCTCTGGTATCAAACACCCGCAGACGACGCTCCGCGC
GTTGTCGTGCCCAACGATGTAAAGTTGCAGCAGACAATCATCAGCGAGTGTCATGACACCAACTACGGCGGCCATCCCGGTGCTGAGCGAACATACTTGA
CACTAGCGCGCCGCTGGTACTGGTCGAAGATGCTGAAGTCCATCCAGAAGTTTGTCGCCGACTGCGAGCCTTGTCGGATGAGCAAGCCGCGGTTGACGAA
ACCTCCTGGGTTGCTCGAGCCACTCAGTATTCCAGACGAGCGTTGGAGATCCATCTCCATGGACTTCATCACTGATCTGCCGCGAACGGAACGGGGCGTC
GACTCTATCTGGGTCGTCGTCGATCGGTTGACCAAGCGGTGTCATTTCGTGCCAACCACCAAGAAGGTGAACGCCGAAGGTGTTGCTCGACTCTTCATCG
ACAACATCTGGAAGTTACACGGCATGCCGACGAATATCGTCTCCGACCGCGACAGGAAGTTCGTGTCCGCCTTCTGGCAGCATGTCTTCAAGTCCATCGG
GACGAAGCTAAGTATGACCGTTGCACATCGCGCTCAAGGTGACGGACAAACGGAGCGCATGAACCG