Description :
From Genome Similarity Track
Location :
Scaffold_3842:18- 1716
Sequence
1698 bases(100 bases per row)
TGGCCAGCGCCGCTTTACCGTAACAATGTAGTGTTGAAGTGGAGAGAGAGGCCGAGCACCTGGATCTCGTTACGTTGAACCGACTAGACGAAGTGGGGGT
AGTTGGATCCGGGAAAAGGACAGTCCAGGTGATGGCCGTCACTAGGTCCAGAGGAAGGATTGGATCCAGCCCCCAAATTCTCGAGGCAACATTTGTGAAG
AGAGTCCGCATCAAGCGGATCCTCAAAGCACAGAACGAGGAAGCGTGGATCCTAGGACTAAAGAAGTATCTGATGGGGGATGTACGAGACCTGAGTCGGG
AAGATGCCAAATCCTACAGCATTATCGCTACGGATTACGCGGTGGATCTGAATGTCTTTCTCTTTCTATTGCCCCCCTACCAAGAGAGTCTATGTAGGAT
CGGGATGGATTGATGAGACTGGTGATGCCGGAAACCTTACAACAGGATGTCCTACACCACTATCACGCTAGCTTGGAAGGCGGACATCAGGGTATTGGTC
GGACCTACCAACGGATCCGGGAATGTTTTCACTGGAGGGGACTATTCAAAAGCGTACAACGGTATGTCGGGGAATGTGTGGATTGTGAGACAGGCAAGGG
CAGGCCCACAATCGGAGGGGAATCACCTGGAAATATCCAAGCGACTTACCCTTTCCAAATCATAGCCATGAGATCATATCCCCTCGTTGCCCAAGTCGCT
CAAAGGAAACACAGAATTGTTGATTTAGGTGGACCTGTTTACCGGATACGTGGTAGCCAAAGCTAGTGCGTCTAGAACTGCGCAGACCATTGCTGAATCG
TACGAGGAGTGCGTTTTCCGAAGATTTGGAGCTAGCGAGATGATTAGACATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCATTCAACCGGA
TCCTGGGGCAGCGACAGCGAGCAACCATGGCATATTGTCCCCAAGCTAACGGGTCGGCCGAGCGCATGGTACAGACGATCCTAGAGCACTCAAGATGTAC
GTCCAGGATTTGGATCAGAGGGATTGGGATGAGTACGCAGAACGGCTCCCCTTCGCGATGAACACCGCCCAAGACAGGATCCGGGGTGATACCCCATTTA
CTTGGTACATGGGTGGGATCCCAAATCCACCCTAGAAGCGGCCATTCCGTTATGCAGCACCACGAAGAGAAACCGAGATCCAAGGCGATGGCGATACCAA
GTCCAGAAATACTACCGGCAAGCTAGATCCCAGGTGAACGAACGACTGCGGAGTGCGATACAGGATCGAGCGGATCGACACAACGAAGACGCCCGTCCAC
ATCAAATCCAAGTGGGATCGCAGGTGTGGCTTTATTTGGATCGAGTGAAAGAAGGGTACGCCCGCAAATTGGCCCATCTATGGCATGGACCGTTCCGGGA
GAGCGAGAAGATTGGAGAACATGCGGTAAAGCTGGAAACGGCAGGTACCGAATATCGCCTGTTCCCTGTAGTACACGTATTTAAGCTGAAGTTGGTCAAA
GAATATCCGGATCGGCCGCAGATCCGTCTTTCGGTGGATGGATCCGATCGCGTCGACTTCGACGAAGTCCTCCTACCGGAAGATAGTTGGAATGTGGACC
TCGAGGCCGACGAGTTCGAAGTCGAGAAGATCACCGATATGAGGTCAGGGAAGCGAACTAGATACGGGCGGATTTACCGTGAATTTCTGGTGTATTGG