Description :
From Genome Similarity Track
Location :
Scaffold_3957:18- 1707
Sequence
1689 bases(100 bases per row)
CCAGAGTACCTTATTCCACATCTTCCAACAGCTCATTGATTAGAAGCCATCGGGATACACCATCAATCGAGTCAGGCCGTTAACCAGCCCGGTAATCAAC
GCACAGACGTATATCCAGCCCGTTCTCTTTGGATGATGATTACCACCGGGGGATGCCCACGTGGACGTTGAGAAACTGTATGATCTTGGCTTGCAGCAGG
CCCTTAATCAGATCCGATAGTTTTTCTCGGAGCTGAGGTGCCACCTTCCGCAGCCTTTGAGCGATCGATTTCGCGTTGCCGACATCGATGTCACATTTGA
CTCCACGTGCAGCAGGCGGTAATGCATTACCTTTACCAATCAGCAGATGTCGGCTTCCCGGATCTTCTGACGTAACCGATCCACTTCCGCGGGTTCGTTC
GCTCCTGGATCCACTTGGATGTCGTCAATCGTGACCTCATCTGTGGTCAGCGGTACCTCCGGGATCACCGCCAGGCCTTCTCCGAGATCCTCGGCGTGTA
GATCCCCGCCTTCATGGTAACATACTTGTTCATCTTCCGTCTTCGTCGGATCCACCATTGGATCCAAGCACCGCGACCCTCTTTCACCTGTCAGTCCTTC
TGTCTTCGTGGGATCAGGTAACCTGGTATCAGGGAAACCACCAGTTGGATCCAGATGGTCCTCTAACGAGTTTAAGCCCGACAGTTCGGGTTTGACTAGT
GTTGCCACTCTCGATAGGGATCCAGGCACTTTATCCAATGGAGAGCTTGGATCCACTTGTGGATCAGCGGGACCTGGCGACTCGACTTCCGCTCTCTGCG
ATCCTCCATCCACCAACCCTGAGCTATCTAGGGGCCGGCTCTGGGCCCCCCCCCCCGGTCTTGGATCCAACCTCCACCGCTTGGACCTCAATCCGACGAT
CTCTCTGTAGGATCTTTCGCGGAGTTGGGTATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCCGGGGCCTCCTCTTCTCCGAGAGATTCAATCTC
GGTAGTCGCCTCGTACGCCAGATTCTGCCATTCTCTGTAACGACGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCCTTCGCCAACCAC
CGTCCGATCTCCTCATAATGGCCCCAGTAATAGTCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACCTGGTCCCCGGATTACGGTAGGC
ACCCATTTCTCGCCCCGAGTGACCCACCGTATCTCATGTTCCACCCACTTTAACCGATCTGTCAGTTCCCAGGTTTCTCCGGGCTCGATCCAGGTCGTCT
TATCCGCCCTTATGATCCTCATCTTCGCCCCGTACAACGGTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCCAG
ATCCAACCTCACTCCGGCTGGTACCATGAAATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAAATGTCAAACCAGTACTCCAAACTA
CATGCCAACGTGATCTTGATCCGCGTTCTCCCGTTCGTACGGTACACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACC
CAACCTTACGAGCAAAGGCGGTGCCCAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGGTGATCTTGCCC