Description :
From Genome Similarity Track
Location :
Scaffold_589:18- 1445
Sequence
1427 bases(100 bases per row)
GGCGAGGCCGAAGAAACCTTTGTCGCCCAGGGGAGTTCGTATAGCGCAGCCCAAGACTGTTCCCCAGGGGTAGACCCAGAGAATCGACTTGAGAGCCAAC
AGCAAGAAGATAGACCCAGAGATTCGCAGCCGCAAAGCTTTAAACCCTGAGAATAACACTCCTTGGTTGGCGTGCCGTACCGTTGTGTAATCCCTGTCGG
CTCGTTTGTCTTCGACGGAACAGCACTCCACCGGTTGAAAATGTTGCCTCGAAGAAGTGCGGGAGCGCACGTCTACTTCAGAACGCACCTCCACACCAAA
AGACAAACCCAGAGAATCAGATCCCCTGAAACCCAGAATATCACGAATTCAGGGTCCAGGATTTCAGTCAACTCTGGGACTTGGAACTCAGAAGACACCT
TACCCAAATGCCCTCCTAGCTCGATAAAACCAACAAATACACACTAGGCTCACTCGAGTCTGAAATTCAGGGGCCTAGCTCCCCTGAGACTCACACAAAC
GCGCACCACCTCCAATAAAGGAGGAAAATACAATCACTATCAGTTACCTTCCCTTCACACAAGCAGTCAATACAAAATCCTGGAGGCGACTACCTAGCAC
CCCAGAATACCCTCTGGAATAATATGAAATGGGCTACCACGAGCACAGCAAGTGACCCAACTAGGATATGGAATAGATGGATCACCCCAGGAAGCTCAAG
GCCGTCGCTGGTCACCACCTAACTGGACTTGAGTTTGATGGAGCCCACACAGACGGCTGTCCTTCGCCGTTGATGTACCCTTAGCGTCCCACGGTCGTAG
TCTCGGGTCCTCCGGATTTCCGTCGGCAGGCTTGGCCGAAGTCACTTGCGCAGTACAGGGTAAAATGAACTCTGTTTGGTTTTTATCAGCTACTTCTCTC
TCTCTCTCTCTCTCTTCTTGGTAACAAGTCTGCTACATTGCAGGCCTGCGTGAATCTCCACAAAGCCACACTTTTAGCGGGTTTAGCGGCCTCCTGCGCA
TGATCACGGTAGTAGTGGGTTGATTCTCAGGGTAATTTGATCCTCTGGGGCACTCTGAGCCACAGCAAGATGAGGTGTACTCTGGGATACATTCTCCAGA
GACACTTTCCGCCAGACTTTAGGCACTCATCGTAAGGGAAAGTCCGCGGCTGGACTGAGTGTTCTCTGAAATTCTGGGCGCGGAAACCCAGAGTGCCACA
CGATGACCCAGAGTTCACCTCCCTGAGTACAGGTGACCCAGAGTTCCAAAGATGATTCTCTGGGCTTGGACCATAAATCCAGACTCTTTATACTGAACTT
AAGTGTTTCCCAAACCAACACCCAAGAATTCCTACAGTTCCCCAATATTCCTCAGAATCCCCAGGATTTCAGAAGATGACCCTGAGTGTCACTTGATTCT
CAGGGATTCAAGTCAGTTCGAAGCCAG