Description :
From Genome Similarity Track
Location :
Scaffold_2160:18- 1080
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2160-fgenesh-gene-0.1Myosin

Sequence
1062 bases(100 bases per row)
CCGAGATGGAGCACACCGGCGAGCACCTCAAAGAGCGGACGCTGGGCCTCGTCATCGAGGCCAATGAGGCTCAACGCGTGGCGCGTCTTGACAAAGTGCT
TGGCGTCCGACGTGCCTTCGATCTGCTGGGACTTGCTGTCGCCCGTGTACCGGTACACCGTGTCGGCTTCCAGCAAGAGCTCCTGTGCGAGATCGCCCTC
GAGGATCTGATAGAAAATGTGGTAGTTGCGTTCCGGCGATTCATGGGAGATCACACGCGTCTTCTCGAGCAGGTATGTGCGACACTTGGCGCCCACGAGC
GTGCCTTCCGCGTCAAACTGCAGCAGCGTGAACTTACCGAATCGCGAACTGTTGTCGTTCCGTACCGTCTTGGCATTTCCAAAGGACTCGAGAAGCGGAC
TGGCTTCAATGATCTTCTTGATGGTCTCGTTGTTGAGACCGCCGGCAATGGTCGCCAAGTGGTTCATGAGAATCTTGGTGGTCTCGGTCTTGCCGGCACC
GGACTCGCCACTCACGAGAATCGACTGGTTGTGTTCCGAGCGGCGCATGTTGTCATAGGACGCGACCGACGTCGCGTACACGTGGGGCGGCAGCTCTTCC
TTGGGGAACTGAAGGTACTTGCGGTGCTCCTCTTCAGCGTACAGCTCGGGCAGCCACTGGTACGGGTTCACGGCAATGCAAATGTCGCCCGTGTACGTGT
AGGGCAGCTTCTGGAGGAACCGCGTCTTGACGTTGAAGAGAATGGCGGCCTCGTGGAGATAGTTGAGCGTGATCATATCTTCAATGCCTTCCGGACCGAG
GCTCTCGTTCTGGTACGGCAGCGACTCGAGCTGGTGCACTTCGAGCAGCGCACGCGTCTTCTTATTGCTGAGATCGACCACGCGCTCTTCTTCCGTGCCG
TCGTCCAGCACGACCTTGGTGTGGATGAGGCGCCCTTTGCCGTCGGCCGTGCGCTCTTCCTTGAGCACTTCGGCTTGGAGCCACACGTGCGTCTCGTCGG
GAACGTAGCACTTGACCCCGGGGACCATCTCGAGGTCGCTCATGGTTGCTTCGTCTCTTCAC