Description :
From Genome Similarity Track
Location :
contig_50:179995- 182523
Transcript NameFunction/comments
g9909.t1hypothetical protein

Sequence
2528 bases(100 bases per row)
CTGCTTCCTTCAGGAGACTCTTGTTCCTGAACGCCAGTCGCTTCACAAACTCAGTCTGGGAGCTTCTCGGTACTAAGGTTCTCAGAGCTCCGCGAGTTCG
CTGCAGCGCCACGAACACGATTGAACTGGTCAGCGTTGGGTGTGAGGATGGCGGCATGAACGGAGGAATGGCCGCAGTAACACGATCTTCTCCGAGACGG
AGAGCTTCTTGAAGTGCTGCGACAACAGTTGACCTCACCTCCTGACGAGTCTTCGAAGTGATCAGCATCTGGAACGAAGCACGGGCGGCGGTTGCAGCGT
CTTCATCTTGTGTGGCTGTCCGTCCAATGGAGAGCAGCCCGCTCTCGGACGCACATCGATCGACCAGCACATCAGCTCGTGGAGTTACAAGTTGGGCCAT
GACGTGCTCACACACGTCTGTCGTCACGTTTCCCACAACAAATTCCACTACCGCCTTCAGCTTCGGATGCACCTTGAAAACCGCCTCGGAAAGCTTGTCG
TTTTCTTCCTGGAGCGGCGATAAAGTGCCGGGGAACGCCGTTGCCGGTGACTTCACTCCGGAAGTGGCTGAGTACCCATCGTTGTCATGCTTTGAAGTGA
AAGACGAGATACCACCGTTCTGGTCATCCTGGATCACCACCTGCAAGGGTCGGAGTTTGCGGATGGGTGTGACCAGCTGGCCTTTAGTTATTCGTCCGGT
GCCAGTCGAGAGTTTCCTGCGTGGTAATGGCTGCGCACGAGTCTGAATGAACCCACGCAAGTCTTCCAGCTCGCTCACGCAGCTCTGGACAAACACTTGG
CTGTACAGGAATGGCAGGTGGTCTTCTCCTTCTCCATCCTCTGACGAGACTCCACCCTCCTTTGTGAGCGCCAAACGCACGTTAGACGGCGGAAGGAGTT
CTTCAGACAGATAGTCGCCGTTATGTATGAAGCCAGCGTCCAGCTTCATTACGTGGAAGATGCGCTCGATTTGCATCGCAATGTAGAGTCCTGTCTCGCC
CAGGGAGTTCAATCGCGGCGACCGATACAGGAGCTGCAGCAACACCACAAGTTGCTTGAAGTAGGTCGTTCCTGAAGACAGTTTATCCAGCGAAAGCATC
GTCAGATAGTCACACAGCCACGGGATGCACTTGGAGATGGATGCCTGGAGGATGCTGTTCTCCAGCAACTTCTTAACGTCGAGACTGGAGTCGCGCGCCA
CCTCTAGTGTGCTGATGCCTTCACGCTCGACAGCCTTGAACGCAGCATTTTGCTCAGAGAGCTGGCGAATCGAGGACGTGACTTCCCATTGCGGCGAGAA
GCGCAGATACCCGAGGAATTTTGCCATCACCTGAGTCTTAACACCAGTTGTGTGAAGTTGTTCCGAGCATCAGCAGAGGGGGAGGTGTTTTCTCGAATGG
CGTAGAATTGCCGCTCTAACTGGTGTTTGACAAGCTCGGAGAACTCGTAGCTATCACAGCTGTGCAGGAAGTGAAAGAAGAAGAGCTGGTTGTCCGTAAA
AAAACTCTTCATCCGATCAAGCGTTGCCGTGAACTTTTTGGTTGCGTCGTCTTCGTTGGTGGTAACTCTCGTGTCCTGCCGGGATTTCCATGGCGAATTG
TTGTTTCCCTTGCCGCCAGTCCTGTTGTTGCTATTGCCTGAGCCGTTCGAGCCGGCGTTGTCACTACTGGTACGCAGATGCGGTGACTTATTCAAAGGCT
TTTGGCTTGAAAAGCGCCGATGCAGCTTGCGCAAACGGTCCGGGTTCTTCACCACGAGTTTATCCTCCATGATCTTCAGCACAAGTTCCTTATCGCTTTC
ACCGAAGGGGTTGGAACCCACTTGCAGTAATTCCTGGACGAAGAATTTGGCGAACCACCACCTGTTCTCAGGAAAGACCTCAGCTAGCAACTCCCGCGCA
AGCGCAATAGCTGCTGCTGCCACACCTGCATTCTCGATGCCGACGAGACTGTGCTGCTTCTGCTGGAATTGACGCAGTAAGCTGAGAAAGCCGTCCCGGA
CCTTCTCGCGGTTTGTGTACAAGAGGGATTCCGCCGGCGTCCGGTAGTGCAGGCGCGAGTCGGTCTCTTCGTTGAAAGGGAGTGCGAAGTCTCGCACGGC
ACTTGCTTTCATCTCAACTGGCAGCTGACAGCCGACCCGAGCACTTTCAGCCACTCGGAGCTCCTCGCGCTGGCGAGACACTTGGTCAAGTCGCTCCAAC
ATGGACGAGCAGATGCCCTCGGCGTCGTGCAGGCTGTGCTCGACTAACTTGAGCAGGTCCGAGCCAAGATGTGTCAGCACCGGCTCAATCTCATGAAACA
CGATCTCTGCGAAGTCGAGACAGTGGTCACGCCAGCAAAACTCCGACGGAGCTTCGCAGTTGTTACCACCATCACTCCCCGGCTGCTCCTCATTGCTGCT
GCAAGCCGTGCAATTGGCCCGATACAGCAGACTAATGAGCACCTGCAGCTCGGCGCACGTACTGCTCACAAACCGCTCTCTGATCAAAAACCCGTACAGC
CTCGCCGCTTGTCGGTTCACCTTGAAGT