Description :
From Genome Similarity Track
Location :
Scaffold_75:179993- 185359
Transcript NameFunction/comments
Hyaar_Emoy2808185Eukaryotic/viral aspartic protease

Sequence
5366 bases(100 bases per row)
GCGATGTGCTCACTGCGGGTCCAGAAAACATGGAGATTTGAGATGCTGGACGAGAATAACCTGCGACCATTGCGGAAAGAAGGGGAACCCATCAGATCGC
TACTTGTTTGTGTGTTGGGGATGCGGAGAGACCCATAAAGTGAAAAAATGCCAACTGGAGGATTTCTACAACTTAATCCGTAAAGGTACAAACCCAACAA
GCACGCTGGAATGTTGCCCGGGAATAGAGAAGATGATCAATTAGAACGGTCGCCAAGTTTGAATCGGGTACGAGTCGAGCGTTCTAGTTTTTATATCTTT
GCATATATGGAAAACCAGCCCGAGAAGGAGGGGAGGTTTTCCATTGAGAAGATCGATTATATATCGAAGACTGGAAACTATCCCATGGTCCATGTTGTCT
CTATCAATGAACCTAATGATTTTGCCCGGGAAAATGCAGCGATGGAGCTAGACCTATTGCCTGGAGAATCATGTAGATACTAGAAATACCACTCCCCAAC
TAAGTGGTTTAAACAAGCCAAAGTCTCTGGTTAGATCAACAACGATCGCGCAAATTTGTTGTTCGATACTGCTTCGAGATATCCATTTTAAATTTCGCCT
TTTCTCGTAATGTAGGTTGCCATATTGACGAAAGCGAACGACAATAATGCATTGGCATTGGAGGATCGGTATACTCTACGGAACGGCATACTCCAATTAT
GGTCACCCTGAATGGCAATTTAGTGTATGTGTTCAAGGTGTGGGTAGGCCCTATGGTGGGTCAGGATGCAATCTTAGGAATGAATTTCATGGTCCCGGAT
GGTATCCGGCTAGATCTGGCGGATGGAACATTACGTCTCCCTAACAAAGTCCGGATACAACTCTTCGGACGAAGGACCGTTCACGATAACCGGGCCATAG
ACGTGAAGATGGGACAATATGCCCGTATACTGGCCGGTGGATGTGTGGAAGCACCCCTTAAAAGGTCAATCTCAGGTCTATGGAGGACATGGGTCACCAG
AGGAGAGCGATGGGTTACAACTATGACCCGGGCAATAGAAAGGCGACAATTGCTGAAAGTGACCAATGTCAGCCCCCACACGTTGATATTACATGGCGAT
ACCAAGATAGGTATGTGGCTGACGAAGGATAAAGTACCACAAGCACAAGGTTTCGTCTCGGTAGGCTCTCCAAGGTACGCGGAGTGGCTGAACCTGGCGT
ACGAAGCCACCACCGACCAGGTCGACCCTCAAGTTGACCTCGAGGAGAAAGGAAGACACCCGTAGTGGAGAACCCGCAGTACAAGATCCCGTCGCGTATT
TTGCAGCGGTCGAATACCCCATTCGCAATGATGAACGTGTTACACCAGCCGTCAACAGAGAGAAAAGAACAGTCACGCGAAGAAGAGGTACCACTACAAG
AAGAGACCGCTCAAGTACGAAGTGGCCCTAATGACGATCCACCGGTAGAGATTGCAGTAGATGAAGAGGAAGTCGACACCCACGAATTGCCACGGGACAA
TGGACAAGTGTGCACGTTCAAAAACGGAGACCTTATGGCTGAAGAAATAAATCGGGGATGGGCAATCATACCGGAAGTGGGCCCCTCCTCGGAGACTATC
GGGTTAGTAGACATATATATCCCTGATCCGGATGGGAACACTTCAGAAGAGGTGGACCGGCTACTCCAAATCATCTGAAAGAGACTACATCTGTTGATTT
GGAAGTGGAATGCCTTACCGCCAGCCACTCGAGGGGCTATATGTGACATTGATGCAGGAAATGCAAATCCGATCGCGCAACGCGTACGGAAAGTGTGCCG
CACCCGTTTCGAAGAAGTTGGCCGACCTGATCAAGGCGCTATTATCTGCGAAGATTATAAAGTCTTCTATGTCTCCCTGGGCCATGCCAATCGTTTTTAT
TGTGAAGGAAAATGAGGTGGACATCAGGCTGTGCATGCCTACAGGTTGGTGAATGACCTGACTCAACTAATGGTCTACCCCATGCCTCTGATTAATGAAT
TATTGGAAGACTTGGACAAGGCATTATGGTATTGCTTACTGGACATGGCGAGTGTTTTTTGGGTAGTCGGTATCGCTGAAAAGGCGAAACGAATTTCAGC
GTTTATGACCCCACTGGGTTTGTTTGAATGGATGCGGATGCCATTTGGGCTCAAGAACGCGCCTTAAATATATATCAGCTACTGTTGGATAACGCTTTAT
ATGGTTTTTTACGAATATCTCCAGGAGCAGAGACAGACGGGTCAGAAGATTTGTTCCAGGTGGAGAGCCAGATTAGCATTCGAGTTCCTCGATCCTGGGT
TTACGGTCATATGTAGATGACATTCTGATCCCCGCCGAATCATGGGATGTATTGTGCACAAAGGTGGAACGTTTGTTGGATGTGTGTGACTACTGGACTT
TGTCGATCAGCACAATTCAGAGTTCGTGGGGATGTAGAAAGATCGACTACCTTGGGCATCGAGTATCTAGTGGAGGGCTAGAGGCTCACCCAAAGGACAT
TCAATCTCTGGTAGACCTGCCCTTGCCAATGACACTGAAGGCCATGAAATCTTTTCTGGGAAGTTAGAATTATTATTGCGGGTTTATTGAAGACTACGCC
ATGTATGCGTCTATTCTCTACGAACTTATAAAGGTATATTTCCGTGCACGGCAAAGCCAGTCGAAGGGAAAAAACAATACCACCACCCAGGACGAGAACG
AAGAAAGGTGGACCCGTGCTCAAGTGGCCTTCGCCATGCTTGAAAATACAATTCACGGCGCCAATTCTGAGGCCCTTCAACCCGACCAGAGAAGCCGTGA
TTATTGTCTATGATAGTGAATGGGCCATTTCGGCGTCACTGGTACAGGATTACGAAGGACTGCTTATACCGGTGGCTTTTACAAGCCGAACCCTCAAGGT
TAATGAAATAAATTACAGTACTATGAAGAAAGAAGTGTTAGCCTTGTTGCTGAAACTGGAGACCTGTTTCACTATGTTGGTCACTCGGCCCCTCAAAGTC
TTGACAAGACACTCGACATTGACGTGGTTAGTGAAATCTGCCGGCGTGCAGGTACGCTTGGGAAACTTGGGCCTCTCTCTTGTCTCAGTGGACTTTAAAG
ATCGTGGATTGTAAAAAGGTGAAGACCAGGTGCTGGGGGAGTTGACAGCCATTATTACCCCTCGAGAGAGTGTAGACTCAATACTGTCGGACATTGCCCC
TAAGAAGCAGGCAAGGCAGACAAACAACCTAGCTATCCCCACCGTGGAACCAGACGAAGAACTGTACGTAACAAGTTTCGATGCGTCAGCCCGTGTTAAG
CAAGGAGGTGGAGATTGTAGCTCTATCGTATGGACTCCCAGCATGGTCCATATTCGAAGCCGCCTCCAAGTATCTCGACACATCTACGGTAAATCAGGCA
GAATATGAGGGTATCTTGCTAAAATTTAGCTTGTTGAAATTTTTGGAGCGGCGACGGTAGATTATCTGTGGAGATTTTAACTTGGTGATGTGGCAGATGC
GAGGGGATATCGAATGTAAGGCCTCGGATTTGGCCCCACTAAGTGCCCGAGCTTTAAGTAGACTTCAATTGTGGCCCTCTCATGGGATCCTACATGCAAA
ACGAAATTGGAATCAGAGCGCAGATCAGTAGACTAGTACAGCCTTGTACCAGAAAGGGGGGATCGATTCGACGCCGAGTGAAGAAAGACCAGGTTTGGAG
ACAATCAACCGTACCGGATCTCCCAGTTCCTAAGGACCAGAGCCTCTCTACCAAAATATTTGCGGTGATTCGGTCACGATCTTCTATTAAGATATCCGGG
GAGACCATGCAAGATGAGGTAGTGCAGCGACTCCGCGTGGACCGAATTCGAAAGGCGCAAGAAGAATAGATATGGGTGAGCTATTTGAAAGCATATTCGA
AGGGGGACTTGAGTGACCTGTCTGTGGAATCTGCTAAATAGTGCAGCGAAATGTCCAGTAATTACGATGTTAGCGAGGAGAAGTATTGGTGTACTGCCCA
AACTCCAGAGCCGAGGGGGAAATCCTTGATTTCACGGTAGACTGGTAATAACGGATAGTCTCCAAACCGACTTTATCCACCACTACCATACGAGTTTAGA
AGGGGGTCATCAAGGGTTCGGGCGTACCTACCAACGCATACGAAGGTACTGTCATTGGAAAGGTTTGTTTCGGAGTGTGCAGAGATACGTAAGCTCTTGC
ATGAATTGTGAGACCGATAAAGGTGGACCTACTTTACAGGGGAATAGCCTTGGGAATATCAAGGTGACCGAACCTTTCAAGATTTACAGCGATGGGCCAT
ATTCCGTCTCTCCCTAAGTCGCATAAAGGACATACAGAACTTCTGATATGGGTTAATTTTTACCGGATAGGTAAGATCCAAGGATAGCGCATCGCGGACA
GCTCATACGGTCGATGAGGGGTATGACGAGTGAGTTTCCCTCGTTTCGGGGCTAGCGAGTCGATCTGTCATGATCGAGAACCAAGATTTATGTCAGATTT
ATTTCGAGCGTTTAATCGTATGGTGGGCCAACGTCAGCAAGCGACAATGGCCTACCAACCTCAGGCCAATGGTACGGCGGAGAGGATGGACCGAACTTTG
ACCAGGTTTATCAAGTTATATGTCGCTGACGTAGGGTACGAGATTGGGACGAGTATGCGGAGCGGTTGATGTTTGCGATCAATATCGCACAAGACCGAGT
GCGAAAAGAAACGCCTTTTTATTTGGTCCACGGTTGAATTGCCGGATCCAAGCCTTGAATCCACGTTACCGATATTGAATATGCAACGTCAGGAGTCTGA
ACCCAGAAGGTGGGGGTACCAAATTCAGAGTCAGTACCAGCGAGAAAGTAAACAGGTGAATGAGAATCTGCAAGAAGCGAGTCAGGCGCAAGTGCAAATA
CTGAATAAAAGAAGGATATGCCAGGAACTTAGCCCAGCTTTGGCACGGAACTTTCCGTATTCTGTAGCTGGTGGGAGACCATGCAGTACGCTTGAAAACC
CGGGGTACGTAATACCGATTGTTCCCGATTATACACATATCCAAGCTCGAGCGCATTAGGAATTTCCTTATAGACCAAAAAACGAGCTATCAGTGGACCA
GGAAGACCGGGTTAACTTCGACGAATGCATATTGCCGAAATAAAGTTGGGTAGAAGAATTGGAAGAGGGCGAATGCGGAGTCGAAGAGATTCTGGAGTGC
CGTACTGGTAAGGAGACGCGTTGTGGGCGACAGCAACGAGAGTTTCTCTCTCGTTGGAAGGGGTATGGGACCCCTCCCGGGTAGATGAACTTAATTTGAA
TGGTGGAGCGAGAGTTTGAACGCAAGCAGATGAGCCATAATCGGTTTAAAGCTATGCAGAGTCATG