Description :
From Genome Similarity Track
Location :
Scaffold_95:17998- 19064
Transcript NameFunction/comments
Phyci_236887Hypothetical protein

Sequence
1066 bases(100 bases per row)
CGTTGACCCGGGGCCACGACTTGTCGTCCGTTCGCCTCACGGAAAATAACCAGAGAGTGGTTTGGTACAACAATGCGGGCAAGGAGGAAGCGATCGAGGA
TATCCTCCGGGCTGGCGGCATGGATGCCGTGCGTCTCCGGTACGCTAATCTCTTTTCCTGTTCCGTTAATAACAATCTCACCCTGCTCATGTGGAATAGA
ATCTGGACGTCGGGCGACTACGACCTCAACTACACGTTGGCGCTTGCCCAACGGTTCTCCAAGGCAGGGTTCAAGATCTACCTGGACATGCATTTTTCCG
ACACGTGGGTTGACCCCCGACACCAAGAAACGCCTGCGGCTTGGGACAGCTCTTCAGTGGAGACCTTAGCTGATGATCTGCAAGCTTATGTGACCTCGAC
TCTCCAGGCTTTCACGGACGGCGGTGTTGACTTGGACATTGTGTCGCTGGGCAACAAGATCACTTGCGGATTCCTCTGGCCGACGGGAAGACTCAACACT
GGTAACAACAATAGATTTGCAACGCTGTGGAAGGCGGCACGTCAAGGCGTCACCGATGCTGTGAAGGCAGGGACCAAGCAACCCCGGGTCATGGTTCACG
TGGACAACGGATGGGATTATGGTCATGTTTCGAAGTTCTTCACGAGTCTTTTTACCGATGGTGCGGTGACTCCGGACGATGTGGACGTGCTTGGCTTCTC
GTTCTACCCGTTCTACGGTGCAGAGGCCACGATCGACGCGCTCAATTCCTCGCTGACCCAAATCGCCAACGACTACAACAAACCCATTTACGTGGCGGAG
ACCGCCTGGCCGGTAGCGTGTGAGAACGTGACGTTGAGTGCGGACTACCCGGTGAGTCCTATGGGTCAGTTCCAGTGGGTGAACGCTATCAAGGAAGTGC
TTGAAGGCCTGCCGAATGGCCTCGGAGGTGGCATTTTCTACTGGGAGCCTGCGTACTTGTCGGTGCCGGGTCTGGGTAGCTCGTGCAAGTCGGCGCTACT
GTTTGATGCCGACTGGAGCTATTCACCGGAGACACGCGCTACGGCGCTCGCGTCCGTCAACATGTT