Description :
From Genome Similarity Track
Location :
contig_47:179969- 182295
Transcript NameFunction/comments
g9655.t1hypothetical protein

Sequence
2326 bases(100 bases per row)
CCTGCATCTACTGAAGGCAGCTCTGCAAAAGAACGAAGTTCGTCGCTTCCACAGGACAACCGAGACATCCTTAGTCTGCAAACCAATGTAACGCGTTCGG
CTTCTGGATCCCTGTTGTTACATAGGAGATCCTCGACGACAAAAGTACTCACGCTGAAATTGCGTCAGAAGTCAAGTAGCATGAAGCTGCCACCAGTAGC
GCAGGATGACTCAACATCGGAACCAAGGCCACTCTCGCTTGCTAGTTCTGGCTCGAGTAGTAAGAAGTCACTAAACCGTCACCCAAAAAGCCTGAGTGCA
GGGGGTAACATCAGTCCCACCGAGAAAAGCGCAAGGGTATTGCTTTCTGCAGTGTCTCCGATCAAAGAGAACGAGGGTTTATCAAATTCAAAGGAATACC
GGAGCGACTTGCGTCGCTGCGGGCGCATCCGAACGGAGAAGGCCGACAACATCATTAATTCCTCTAAGAATGGCCCTGTTGGAGCATCTAACGGCGCCAC
AGCAAACGCAGCCACGATATGGGACCCCGTGCATGGTGTGTGTCAGCCTTTTGCCGTTTTGGGGTTCATGAAGGAGCAAACAGCTCGACCAGCGTCGAGA
GGATTATCCTTGTCGTTATCGTCAGCCAAGTTGGGCAGATCTGCGAAGTCAGCTGCCGATCATCTCCGTAAAGCTGCAGTCACTGCTGCAATCGCTTCGG
GGCACACAGAGTTCACACGCTTCCGCATCTTTGGGAAATTCCGTGACGTTGACGATGCGCTCAACCTGTTCCGACAGATCTGCGCTGTAGAGAAGACCCC
GAAATTATCAGAAGGCCAAGACTGCAGTCGGTTCGCGGTCTACAAAGAGGACGAGATGACGATGGCACTGGAAAACTTCCCGAGTGTCGACATTAGGGAC
GCAGGACACAACCAGTTCAGTGCGGCGGACCTGCCGCAAGCTACGGGCCAGCGATTCGCGTGCGTCAGCGTCTCCCTTCAGTCCACTGGAGCCTCCTGCA
TCGAGTCAATTGTAGTGCACGTGTACCAGTGTTTCCCCACTCCCCAGAGCGCCGTGAGGTTCGCTCGACAAGTGGCTGCAACACTTTTGGCTCCGAGCGC
GCTGAGCATCGTGCCGTTGTTCGAGTGGATCGCCTTGGCAGAACTGGAGCGATTCGACGCTCGCAACAACGACCTGGAGCAGGAATTGGAACTCGCTATG
CGTCGCGGGGGGCAGGAGAGCACGTGGAAGGCCAGGAAGGAGGCTCTCAAGAAAGGCGTCCGACAAAGCAAGTTGAAGTTGGCTTCAACATGATTTTTGC
AGTGTAACGTAATATTCGCAATAACACATTTTCATTTTCTCTTCTCTTGCTAGACGCTTGCAATGGCTCCCCGTACGGCTGTGACGCTCAACATCTACGA
CCTGGTGGAGGCCAACGAGTTCATAGCGCGTACGTGTGTGCGTGCGCAAGATGTCCAGCTGTGTGTTGCCTAATTATCGCCATGGGATTCCAGCGCTGGG
GCTCGGCATCTTCCACAGCGGCATCGAGATCGCAGGAGAGGAATTTTCCTACGCGAGCGGCGCCGGAATCTTCTCGTCGAGCCCCAAACAAGCACCCGGT
AACCAGCGACTACATATTTGCCATTGTAATATGTACTGGTATTCAATTGATTGCCTTGTGACTGCAGGCGCCAAGTTTCGGGAGTCTGTGGCCATGGGGT
TCTTCGACGGAAGCTTCCAGGAGGCCCATCGCCTCGCCTACTCCCTGAGCTCGGACTTTGAGGGAGGAGCCTACAACCTCTTCACCAAGTACTGTAGTCC
ACAGCGATATATTCGTTAGACACAAGGCACTGAAAGTCTCACTTGTGAGTTGATTTATTTCTCTACCTGCAGGAACTGTAACTCATACGCGGACGCTTTG
TGCCAACTGTTGCTCGGGAAGCCCATCCCGGCCTACGTGAATCGAGCGGCTTACTTGGGCTCGTTCCTGAGCTGCCTCATGCCGGCGGACCTGGCGGACC
AAGCGCCCGTGGGAGACCCCAACACGCCCTCGCGACTCACGAATGGCAGCCCACAACGCTCGGACTTTGTCTACACGCCATTTGCTGGTGCGTTTGCTGC
AGTAGTTTGATAATATTTGGACGGGCGGCAGTGCTAACGCCAATCGGGTCAATGTGTAGGTTCTGGACAAAGTATGGGCAGCACTGCGGACTCCTCAGCG
TCTTCGGAGTCATCGTCACTGGCAGATCGTCGCGAGAAAGTTCGCCTGGCAGCTTTGCGGCGAATGGGCGAGCCAGAGCAGTAGATTCGTGCAATCCCTA
CCGAGGTGCAGCCTTGTACACGCGCA