Description :
From Genome Similarity Track
Location :
Scaffold_62:179965- 182653
Transcript NameFunction/comments
Phyin_T30-4PITG_18423Putative uncharacterized protein
Phyin_T30-4PITG_18424Snurportin-like protein

Sequence
2688 bases(100 bases per row)
TGCTCTCTCGCGTGAGTACAACGACAGCTTTGTGGAGAGCGACGAAGAGATTGAGGAACCATCGCTGGTTATGCCGAACCGGACAGACTTCTCCCAGTCG
TACTTCTTTGGCAATCTGCCAGCGCATTATCGAAAGGTGACTTCATCTGGATGGCGAGCTGGCAGTGGTGTCGATAACGGGGACGAAGAATTCGAGGAAG
AAGAGCAACTTGAGCGGGAACGTGAGCGACAGCGTTTGCTGGAAGAGCAGGAGGCGGAGAGGCTTCTGGAGCTGGAACGGCAAGCGGAGCGAGCTCGTAT
CGAGAAAGAACGAGAAGAGAAAGCCTTTCAATTCCGCCGAGTACGTCAAGCTGAACTGAGGAAAGTGTTGCAGCACCAAGCCGACCTGGAGGTCTATCGT
AAAGCAGATCTTGAGTTTGCGCGTGAGCGAGCCGAGCTTAACCAGATGCAGCGGGAGGACGAACACTCGTGCTGGCATCGTGACCAACTTTTGCGAGACC
AAACAGGGATGCGACTTGAGGATGAAGTTGCCTTCTGGATCAGAAAGGTGCTGCACAAAGCTGCTGCTGCAAAGGTACGCCAGCTACTGCAAGAACAGGC
TAGCATGTCTGCAGAGGATCAGGGATCGTCACGGATCGCCAAAGAACTGCGGGAGCTTGAGCGCGACCAGGCTGTGCGTACTGCATCGTTATCAGACCTC
TACACTCCATTCCGTCCGTTTTATCAATTTTCGGCAATGGCCTCCGAGGACTTCCTTCCTCAAAATCAGTGGAAACTGGAGCAAGAGCGGCTGCGACGAA
CACCAGTAAAACCAGTGGGATGCTATACGATCCCGCTAGAAGAGGCACTTGTGTTTGATGAACTGGATCAGGAGCCGTATCTTGCGCGAGATTCACGAAA
ATTTAAACTTCTCATGGGTCTACCATTGCGAACACCATGTAGCCAAAAGCGTCCTCGAATCCCAAAAGCGGATGACATCATCGCAATGCGACAACAGCAG
CGAAAGCTAGCTGAATCTCGTGAAGAACGCCAAGAAACGTTGGCGAAAATCCCGCAGAAAGGTAGATCACGCACTCAAGTCGACAGTTCTAGCGAGCACA
GCCGCCTACCATCCATCACTCCTCACACCCGTTCCTTAAGCAGTCTGACTGAGCTCAAAGACGCTTGCAGAAAGCGAGATATCGTATCCGCTGCCAAACA
CAAAACCAGTAAAAACAATCAGCAACAACAGCAGAATCAGCAAAAGCAGTCGCTGCCATTCTTTCGCGGAAACATGCTAGTACAAGGCCACGGCCAAGCA
CGATCAGGGGACAATGCCTACTAACCCCCACCGTTTAGCTCAGCCGAAAGAAGATTGTACTGCTCATGTGGTCTATCCTTCCATCTCCACCTCAGTAATC
GGCGCGTGAGCGGCCTACTCGGACAAGAAGCAGCATTAAGCGTAAGCAAACAGTTTAGTAGGTATGCGCTCCACACAGACAAAACAAGCACGCACCTCTA
AGATACGCTCAATAGGGACTCCACCCAATCGCGCGTTGTACTGGAACAAAATTTTAGTCCAGCTGTCCGGGAGGGCTCGCTGGGGCGAGCATCGTTTCAC
GAATGTCAGACCGGTCAGATGCGGGGTCTGGTTCTCATCTACTTCATGTTGCTCAAAAGAAAATCTCGCGAGATCCCCTTCGCTTAGCTACAAACAAGAG
GTTATCGATAGCAAATGATAAGAACCATCACTTCAAAGTTTAAAATTCCACACACCAAACCCAAACCTCGTGCTGCTGGATGAAGCTTTGATCGGCGGTG
AAAAGAACGATGCCCTCCAAGGTCACACACTCGTTTTCACCTTCGAAGCGAAGCACTACGGATGGCTTGGCCGAGTAGGTAAAGAAGCGACTGGTGTTAG
CATCCTTCCACACCAGTGCCAGTGGTGACAGACCCATCTCGTAGTGGCCTGCCTTCATGTAAAAAAGAAGCTCATCTCTGGCCACACAAAAAGTAAATAA
ACTATAGATCGGGTCCCCACACAAGAGGGAACTTACTTGAGAAATGGATACGTCGTTGAGTATGCAGATACGATGCTCTTCTTGGTCGCACTCATAGCAC
GGAATGGGCTAAACCACCAAAAATTCGGAGTAAGTCCATACCCGGGATCGCCAAACAATCATTTGTAGGCACATTGGGATACCCACCAGAAATCGGAATG
GATTAGCCGGTGTGACCGTCCCCGCAGCTCCTTCCGACAGTTTATCGCGCATCCAGTACAGCCTAAACTCTGTTGTGCAGTTGTAGAGCAAGTATCCCTT
CCAGCACATAACGTCCAGTACGTAAAAGGTTCCGTTTTGCTCTTGAAAGATGCAGTCAAGGATGCAGTAGCCGTCGCTGGACTTGTTGGTCTTGTGAGAG
CCACAAGGCAGCGCAGACGGAAATTTTTTCAAGATAGACCCCGACGGGATCCGAGCAATGGTATTACCGCTACACACAGACACATTTCGCAGGTTTAGTA
ATAATTTCCATCCATACCCCATATCTAAACTCAACTGCAATACCGGTACCCGTTGGCCACTATGAGACAGCGCTTGCCCTCTGGGCGCGGCAGAACATAC
CAACCCTCGCCCAGCAAACTGCCGCTACCGTTGAGGTCCTTGGGAGCGTCAATGAGCCACTCCGGCGTCATCAACTGCTTGGAGAAGT