Description :
From Genome Similarity Track
Location :
Scaffold_65:179834- 185705
Transcript NameFunction/comments
Phyca_LT153420507fatfree family protein putative
Phyca_LT1534574796Drug/Metabolite Transporter (DMT) Superfamily
Phyca_LT1534536870cytochrome c peroxidase, mitochondrial precursor

Sequence
5871 bases(100 bases per row)
gcctgctctcctggtcctgtaggccgtagtagctgctcagcagctcctgcatgcggttcatgccgtgatcctccatactcgttgaaaattgagaaataaa
agaatttacttcattatgattggctggacgctgttactattcttacttctgattggttcattatggtttgcgatccagcatctcacttcattttcaattt
gatctcctggaggcacacagtaaaatggacctgaagcggctgttatgggagtcgaagctggcggtggcgctctgtctgctcatcatggcgcgatgtgttg
accgcgtgctgtacacgtgcgtgaagatctcgtaattacttagaattcactgtactaatgtctgttgactgtagacgaatcacgtatgactacacggaat
tcctctggtactttacgaacgtgatcctccccatcgctttccttgtctcgtcagctccagtagtcgcgtacgtatctgtaactgagtaattttgaagtgg
aagactaatatcgtgtggatttgaaacaggtacaagatctacttcacaggtaggaagaaccagcctacactttaccggtatttgtaattgattgaagcct
tgctgtagatgacatcacacaggaaatgcgcgagttcccgcactacaagtacatgctcatggcgctgttcgacacgctgtacaacctgttgggcgcgttc
cccacgcctcacatcgggtgagactttctgtcatgctggatactgtaaccttatagactcacttgtacggttggacagggggaacatggccaatgtactg
aatcagttgaacctgccgttcaacatgttgctgtcgtacatgttcctgcagacacgcttcaagcgtggtcacatcttgggctccatcctagtgctgtacg
gcggaatggtcaacttgatccctgccctaacaggtcaagacaacgcaaacacgccggaccccagcgtagggtggatctcgctctacattgtttctttggt
gcctgctgcggcatcgaatgtctacaaggagatcggactgaaggacgtggacctggatatctggtacgccaatatttggatcagtttctaccagctcctt
atcggcttcgcgacgatttggactgtacgcatcaaggcgttcagcgatccaccggttccttggggtgacttcccgtcatacgtgtggaaagctcatgagt
gtttcatcgggaacgcagttgagctgaacggaaaggacctgccgtgtgattcgggagtgctggaggttttcttagtcttcattatcttcaacactatgta
caaccaactgatgctgtacatcttcaaggaaggcagcagcgtgctcttcgtggtgtcttcggccgtgggtcttcctctcaccgatctactgtacatgatc
cctcttctgactggcaagatggctggtcaggcctttacaatctatgatggcttcgcccttttcgtgcttgtgatggggttattggtataccattccgaga
aggaagagcgcaaacgcggcacgcagtcggtggagaagtcccctatgtacgcgtcgccttcactgcagaagactcatctcatgcgcaagcgtcgtggaaa
agtggtgtatcgtcaaagtcccatgattattcgcagtggcagtggcagtgacatctcgcaacggcttttagctcgcacgggggccaacaggaataatacg
tacggctcgaatggcaacacagtgcgccaagcgggagacaatggataccaaccataagctttgccaaataccaagttcagtctgcaagaatcctgctcac
gcttcgcttaatagagggatgttttagctgcagtgttcgttttgctgtgatgggagacttcgcttcaacattgtgttagaagacgtcggcgtgtctgagg
tgacaatccgtccgagggacgggaagtatctgtctcctttcttttcgcgacgagcttttacgttcacgtaatggccgaagtgatcaacatcttgagagaa
aatgtagctgttctcgcgtacatcatctttatcatattgtgatcctccaggtgtcattgtcgattgttttctcatgttcagtgatgcactggaaccgaac
agaggatcaagcatcaagcagtatgctgaatccttattccgctgcttggttttcgaccgaggtcttgcgaaaacatagtgatactgtggggactcgaaag
agggttgagctttgttattcccagttggtctagtcgaagcaatattcactccattcaagcatacgggcgactttgaccccccgtcaagcacaagaaccgt
tggaggagaagttggtggggacctcaatgcaattccagtcatttttcgagaagtaggagtctcatctgaacgactatggggagacttcggaagaactgga
aaagaagaacaagtttgacgttggttggccagttttggcgaaacttctcctttaaactcggttcttgacttgtgctgttcctgttgtcgttcctgtcgtt
gctggtgctcgttgatgtacgctatcgtctcccgagccaattctccaacggatttcttgtctcgcaaagccatgggtttgttcttcaactccattgcgaa
gtcaaaggcgatctgttttactctctccatcaccaatggcaatgatacttcatccttgttgtccgatttcttctttacgtccgaaggcaatcgatcacct
gcacctttggcatttatcaagtaagtatggaattcaccaaatggatacgacgcaacagatcggataatggtcacagcgtcgtactgcaaagactcgaggt
ggggatttggacttccatcgagacacagtcgagaaagaaacggaaatatcaactcgacgatacctaaggctttcactcgaggtacacacacgagcacgtc
ttggcttagtgctgcgatagcgctaacagcatgaaccaaaagcctccatttgttcactgtgtccttctttttcgatgaagctggagcgtatacaagatct
cgatgttgtaccaggaccttcgaaagaagttccaggactttaaagtgcaaaaagagctcacttgtgcacccttcgactgcgttgaccattgccaggttag
aaataaccacagcaatttcgcttttgcactcgtcatcaagcgcaggagaacttggatgccgtaattgcatacgcttgagaagacgaggaagcgcctgagc
acgcattatcccagctcgtccgtcagccacagcacataacttaccaaaaagcgtgtaaagcgcagcgggtacgtccagaagttcatgatcatcaaccgat
gaagtaaactcggcagtttttcgtgttggagatgctgttccagttccaattgcgatcattatgtctggtaggtgaattaacgctgtttgtaagcaccctt
ggctcagtaacagactgcaggcagagttactgcacgacaatcgacttaaagccacgcaacacgcgctaatcaggtcaaaaccggcacttttttcgcgaag
aatgtgctggatggctggtgcagccacttcaacgagcttcaacagcttctcttgtgcgtatttcccgtgtggattgtcaccgtgcgacttcaaaaactta
ttgcgagcactttcgccgtaaggcagcggtcggagatatcctgctagttcaactgctgccacaaccttctcaacttcgactctttccgctgcatcacttg
ggactcggataagcgcgatgaggtcctcaagcacgtgcatccgaaacatgacgtcacagatcaacgcttggggccattccggtacttgaggggaagtgag
agatggccgaagtctcgcatctaccatgttactcggacaccgagctaatcgactaagcgctttgcaggcctctttagaacccaactcatgcacgaagcga
tcaccagatgaactgtgagctactaggccttcaattttatccaagtggttgcactgtagagataatgcaagatgatgacaacgtcctcggagaaacacgc
tcgggctacatgagtaaccttgcagaaccgaccaaggagaatgcagctgatgttacgctgtcgtgagttttgtactggagactccatgcaacgtggagaa
acttgagttagaaacagcacgagggtctgcagcgcgttggtggagaagaagaaggtcgctgtcctctcggaggaacgtggtgcggcttcatcttgcattg
cgaggtccagcaaaagcgtgtacaaagcgtcgagtcgatcctcgaatgtcgctaaagctgctaccaatgccgtgaccggtttctcctgatctgtttgcct
tgccaataacgcacagcctatgagtcccattacgaacgtcattgacgattcgcaggcttcaaaactcggtcgacaccagcgcaggaaaatctgcacagca
cccgctgttgtgagaccgtatcgagcatcagagcggcaagtaacttcataaaacagcgccactgctgcatgggcaacaggtaagacgttgtctttcatgc
acaataaaacttgttcaagccatctccctccatctcgagtgagggcatccagcaacttagaaaacccgagagaccgtgccaacagacacagaatccccag
tacttgagttcgcagtacatcatcgacatttcgagaaaaactgagaacctcgaacagtgtgtcaaaaacgtcggtagtaagcagaaactggtgcgctgtt
gtcttcaacttcctcatcatgaaactcctctcttcttgaacatggtctttcacaggtgaatgagctctttgacttgctggagggtttaccgaccgttctg
ttgcctgaaaaactttggtagtgattgagtgtagtaaattgagcgaacttgtaagagaagtcgacgaacttttaccgctgcacgtttgcatgatggattt
caagtccagttgtactctctgcacgatattgcactgaagaatttccacaatttgttcatctccatggccttcgatgatactggacactattcctttcacc
aattcaattacttcccggttctgctgcctcgtaatgagcgatgccagacatacaagtagacctgacccaaggattcgtctctgatccgacagcacagtgt
tacgggtcttagaatgagtcccgtgctgaatcttcgacaaatggtacagtatcatgatgtatgcctgagtcacggtgtttgggattccttcgggtccaac
agcctcccgatacactttgaactggtggcgcagttcgacgaatttgatcatatgcatagagcgtaggcgagtccggacgatcggatcgcactcacgctga
tttagtgatcgctcgaacagcactcctcgccaatggtgctggagaatccgtgcacacaactcaacctcacgcaataaacagccaatgctcttgctcacag
cgttttcgactgacaggacgtgcgcaaaccactccgctagtactgctacaaggcgagctacacgaaagatcttggtgttgtcagtatgtttggttagagt
ccggaatgccttattagtcaggctcggtaacgacgtctccacataatccacagcatctacagtaaggatcaaaatgtgagcactagcaactacaacacca
gatcttgcattaagaaacgcttacatacccaccttcatgagtctccatcaaacggagaagcatggtagttgcaagtttacgtcgcgaatcatcgtcggag
tgctcaatctcttcgtacagggtgtcgatagcactttggattttggttttgttccatcctcgtgtgtcccattcctgatccatcagcatagttgcctaaa
cgccaagaaagcatcagcatcaacatccagcaaacgctgtcgagatctcttacaattcgtccgtctgccat