Description :
From Genome Similarity Track
Location :
contig_47:179824- 181356
Transcript NameFunction/comments
g7841.t1hypothetical protein

Sequence
1532 bases(100 bases per row)
GTTCGTCGCTTCCACAGGACAACCGAGACATCCTTAGTCTGCAAACCAATGTAACGCGTTCGGCTTCTGGATCCCTGTTGTTACATAGGAGATCCTCGAC
GACAAAAGTACTCACGCTGAAATTGCGTCAGAAGTCAAGTAGCATGAAGCTGCCACCAGTAGCGCAGGATGACTCAACATCGGAACCAAGGCCACTCTCG
CTTGCTAGTTCTGGCTCGAGTAGTAAGAAGTCACTAAACCGTCACCCAAAAAGCCTGAGTGCAGGGGTAACATCAGTCCCACCGAGAAAAGCGCAAGGGT
ATTGCTTTCTGCAGTGTCTCCGATCAAAGAGAACGAGGGTTTATCAAATTCAAAGGAATACCGGAGCGACTTGCGTCGCTGCGGGCGCATCCGAACGGAG
AAGGCCGACAACATCATTAATTCCTCTAAGAATGGCCCTGTTGGAGCATCTAACGGCGCCACAGCAAACGCAGCCACGATATGGGACCCCGTGCATGGTG
TGTGTCAGCCTTTTGCCGTTTTGGGGTTCATGAAGGAGCAAACAGCTCGACCAGCGTCGAGAGGATTATCCTTGTCGTTATCGTCAGCCAAGTTGGGCAG
ATCTGCGAAGTCAGCTGCCGATCATCTCCGTAAAGCTGCAGTCACTGCTGCAATCGCTTCGGGGCACACAGAGTTCACACGCTTCCGCATCTTTGGGAAA
TTCCGTGACGTTGACGATGCGCTCAACCTGTTCCGACAGATCTGCGCTGTAGAGAAGACCCCGAAATTATCAGAAGGCCAAGACTGCAGTCGGTTCGCGG
TCTACAAAGAGGACGAGATGACGATGGCACTGGAAAACTTCCCGAGTGTCGACATTAGGGACGCAGGACACAACCAGTTCAGTGCGGCGGACCTGCCGCA
AGCTACGGGCCAGCGATTCGCGTGCGTCAGCGTCTCCCTTCAGTCCACTGGAGCCTCCTGCATCGAGTCAATTGTAGTGCACGTGTACCAGTGTTTCCCC
ACTCCCCAGAGCGCCGTGAGGTTCGCTCGACAAGTGGCTGCAACACTTTTGGCTCCGAGCGCGCTGAGCATCGTGCCGTTGTTCGAGTGGATCGCCTTGG
CAGAACTGGAGCGATTCGACGCTCGCAACAACGACCTGGAGCAGGAATTGGAACTCGCTATGCGTCGCGGGGGCAGGAGAGCACGTGGAAGGCCAGGAAG
GAGGCTCTCAAGAAAGGCGTCCGACAAAGCAAGTTGAAGTTGGCTTCAACATGATTTTTGCAGTGTAACGTAATATTCGCAATAACACATTTTCATTTTC
TCTTCTCTTGCTAGACGCTTGCAATGGCTCCCCGTACGGCTGTGACGCTCAACATCTACGACCTGGTGGAGGCCAACGAGTTCATAGCGCGTACGTGTGT
GCGTGCGCAAGATGTCCAGCTGTGTGTTGCCTAATTATCGCCATGGGATTCCAGCGCTGGGGCTCGGCATCTTCCACAGCGGCATCGAGATCGCAGGAGA
GGAATTTTCCTACGCGAGCGGCGCCGGAATCT